Sam’s Notebook: PCR – Crassostrea gigas and sikamea Mantle gDNA from Marinelli Shellfish Company

After yesterday’s PCR debacles, I re-ran the PCRs with the original cylcing parameters, on a long 1.5% agarose (1x low TAE) gel.

Primers and cycling parameters were taken from this publication:

SR ID Primer Name Sequence
1727 COreverse CAGGGGGCCGTTCGCGGTCAACGCT
1726 COCsi546r AAGTAACCTTAATAGATCAGGGAACC
1725 COCgi269r TCGAGGAAATTGCATGTCTGCTACAA
1724 COforward GGGACTACCCCCTGAATTTAAGCAT

This is a multiplex PCR, where the COforward/reverse primers should amplify any Crassostrea spp. DNA (i.e. a positive control – 697bp) and the other two primers will amplify either C.gigas (Cgi269r – 269bp) or C.sikamea (Csi546r – 546bp).

Master mix calcs:

Component Single Rxn Vol. (uL) Num. Rxns Total Volumes (uL)
DNA 4 NA NA
2x Apex Master Mix 12.5 18 225
COforward (100uM) 0.15 18 2.7
COreverse (100uM) 0.15 18 2.7
COCgi269r (100uM) 0.1 18 1.8
COCsi546r (100uM) 0.1 18 1.8
H2O 8 18 144
25 Add 21uL to each PCR tube

Cycling params:

95oC for 10mins

30 cycles of:

  • 95oC 1min
  • 51oC 1min
  • 72oC 1min

72oC 10mins

Used the GeneRuler DNA Ladder Mix (ThermoFisher) for all gels:

GeneRuler DNA Ladder Mix

Sam’s Notebook: PCR – Crassostrea gigas and sikamea Mantle gDNA from Marinelli Shellfish Company

After isolating DNA earlier today, I ran PCRs on all the samples.

Primers and cycling parameters were taken from this publication:

SR ID Primer Name Sequence
1727 COreverse CAGGGGGCCGTTCGCGGTCAACGCT
1726 COCsi546r AAGTAACCTTAATAGATCAGGGAACC
1725 COCgi269r TCGAGGAAATTGCATGTCTGCTACAA
1724 COforward GGGACTACCCCCTGAATTTAAGCAT

This is a multiplex PCR, where the COforward/reverse primers should amplify any Crassostrea spp. DNA (i.e. a positive control – 697bp) and the other two primers will amplify either C.gigas (Cgi269r – 269bp) or C.sikamea (Csi546r – 546bp).

I ended up running this PCR two times, due to:

  1. Ran the gel too far and ran most of the target products off the gel!
  2. Many non-specific bands produced.

First PCR info:

Component Single Rxn Vol. (uL) Num. Rxns Total Volumes (uL)
DNA 4 NA NA
2x Apex Red Master Mix 12.5 18 225
P1 Mix 1.5 18 27
P2 Mix 1.5 18 27
H2O 5.5 18 99
25 Add 21uL to each PCR tube

Cycling params:

95oC for 10mins

30 cycles of:

  • 95oC 1min
  • 51oC 1min
  • 72oC 1min

72oC 10mins

Run on 0.8% agarose gel.

Laura’s Notebook: Oly methylation analysis, Nov 20, 2019

Revisiting Oly methylation data. We now have two lists of loci:

  • 1) DMLs between two Olympia oyster populations, Hood Canal and South Sound, which were identified using MethylKit.
  • 2) Loci where methylation status is associated with oyster shell length, filtered by a) loci have 10x coverage in all samples, and b) loci have 10x coverage in any sample.

Today I re-plotted heatmaps using MACAU loci, based on feedback from Steven & Katherine:

  • Only use loci with 10x coverage
  • Add heatmaps where samples are NOT ordered by cluster analysis, but instead by 1) tree from MethylKit, and 2) shell length. See my notebook, 06-analyzing-MACAU-results-rev1.html, and here’s one of the new heatmaps, with samples (columns) ordered by shell length, and a barplot of shell length below (red = Hood Canal oysters, green = South Sound oysters).

69304438-6e9ddb00-0bd5-11ea-950a-64b24e80fbf4.png69304447-78bfd980-0bd5-11ea-995a-149f7b6a6b83.png

Then I used bedtools to see where DMLs and MACAU loci are located, see my notebook here:
07-DML-MACAU-annotation.ipynb.

Finally, I began annotating loci locations for DMLs and MACAU loci; see my notebook: 08-Annotations.html. Here’s a barplot showing which features overlap with the DMLs: image

from The Shell Game https://ift.tt/2XylXcL
via IFTTT