Sam’s Notebook: PCR – Crassostrea gigas and sikamea Mantle gDNA from Marinelli Shellfish Company

After isolating DNA earlier today, I ran PCRs on all the samples.

Primers and cycling parameters were taken from this publication:

SR ID Primer Name Sequence
1727 COreverse CAGGGGGCCGTTCGCGGTCAACGCT
1726 COCsi546r AAGTAACCTTAATAGATCAGGGAACC
1725 COCgi269r TCGAGGAAATTGCATGTCTGCTACAA
1724 COforward GGGACTACCCCCTGAATTTAAGCAT

This is a multiplex PCR, where the COforward/reverse primers should amplify any Crassostrea spp. DNA (i.e. a positive control – 697bp) and the other two primers will amplify either C.gigas (Cgi269r – 269bp) or C.sikamea (Csi546r – 546bp).

I ended up running this PCR two times, due to:

  1. Ran the gel too far and ran most of the target products off the gel!
  2. Many non-specific bands produced.

First PCR info:

Component Single Rxn Vol. (uL) Num. Rxns Total Volumes (uL)
DNA 4 NA NA
2x Apex Red Master Mix 12.5 18 225
P1 Mix 1.5 18 27
P2 Mix 1.5 18 27
H2O 5.5 18 99
25 Add 21uL to each PCR tube

Cycling params:

95oC for 10mins

30 cycles of:

  • 95oC 1min
  • 51oC 1min
  • 72oC 1min

72oC 10mins

Run on 0.8% agarose gel.