Sam’s Notebook: PCR – Crassostrea gigas and sikamea Mantle gDNA from Marinellie Shellfish Company – No Multiplex

Primers and cycling parameters were taken from this publication:

SR ID Primer Name Sequence
1727 COreverse CAGGGGGCCGTTCGCGGTCAACGCT
1726 COCsi546r AAGTAACCTTAATAGATCAGGGAACC
1725 COCgi269r TCGAGGAAATTGCATGTCTGCTACAA
1724 COforward GGGACTACCCCCTGAATTTAAGCAT

Instead of running a multiplex PCR as before, I ran each set of species-specific primer pairs independently.

The COforward/reverse primers should amplify any Crassostrea spp. DNA (i.e. a positive control – 697bp) and the other two primers will amplify either C.gigas (Cgi269r – 269bp) or C.sikamea (Csi546r – 546bp).

Master mix calcs:

Component Single Rxn Vol. (uL) Num. Rxns Total Volumes (uL)
DNA 4 NA NA
2x Apex Master Mix 12.5 18 225
COforward (100uM) 0.15 18 2.7
reverse primer (100uM) 0.10 18 1.8
H2O 8.25 18 148.5
25 Add 21uL to each PCR tube

Cycling params:

95oC for 10mins

30 cycles of:

  • 95oC 1min
  • 51oC 1min
  • 72oC 1min

72oC 10mins

Used the GeneRuler DNA Ladder Mix (ThermoFisher) for all gels:

GeneRuler DNA Ladder Mix