Sam’s Notebook: PCR – Crassostrea gigas and sikamea Mantle gDNA from Marinelli Shellfish Company

I ran this PCR a couple of times before and, embarrassingly, I had ordered/used the wrong primers.

Well, I ordered the correct universal cytochrome oxidase primers and used those!

SR ID Primer Name Sequence
1739 HC02198 taaacttcagggtgaccaaaaaatca
1738 LCO1490 ggtcaacaaatcataaagatattgg
1736 COCsi546r AAGTAACCTTAATAGATCAGGGAACC
1735 COCgi269r TCGAGGAAATTGCATGTCTGCTACAA

Primers and cycling parameters were taken from this publication:

Universal cytochrome oxidase primers were from this paper:

This is a multiplex PCR, where the HC02198 and LCO1490 primers should amplify any Crassostrea spp. DNA (i.e. a positive control – 697bp) and the other two primers will amplify either C.gigas (Cgi269r – 269bp) or C.sikamea (Csi546r – 546bp).

Master mix calcs:

Component Single Rxn Vol. (uL) Num. Rxns Total Volumes (uL)
DNA 4 NA NA
2x Apex Master Mix 12.5 18 225
HC02198 (100uM) 0.15 18 2.7
LCO1490 (100uM) 0.15 18 2.7
COCgi269r (100uM) 0.1 18 1.8
COCsi546r (100uM) 0.1 18 1.8
H2O 8 18 144
25 Add 21uL to each PCR tube

Cycling params:

95oC for 10mins

30 cycles of:

  • 95oC 1min
  • 51oC 1min
  • 72oC 1min

72oC 10mins

PCR reactions were run on a 1.5% agarose, 1x low TAE gel with ethidium bromide.

Used the GeneRuler DNA Ladder Mix (ThermoFisher) for all gels:

GeneRuler DNA Ladder Mix