Transcriptome Comparisons – C.bairdi Transcriptomes Evaluations with DETONATE rsem-eval on Mox

UPDATE: I’ll lead in with the fact that this failed with an error message that I can’t figure out. This will save the reader some time. I’ve posted the problem as an Issue on the DETONATE GitHub repo, however it’s clear that this software is no longer maintained, as the repo hasn’t been updated in >3yrs; even lacking responses to Issues that are that old.

Here’s the error message and some other details that could be useful for troubleshooting (which are beyond my knowledge – although I suspect that the XM tag is the culprit and the first entry in the BAM file has XM:i:2 and the error message might suggest that 2 is not an acceptable value e.g. Assertion val == 0 val == 1 val == 5’ failed.`):
rsem-synthesis-reference-transcripts cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta 0 0 0 /gscratch/srlab/sam/data/C_bairdi/transcriptomes/cbai_transcriptome_v3.1.fasta Transcript Information File is generated! Group File is generated! Extracted Sequences File is generated! rsem-preref cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta.transcripts.fa 1 cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta Refs.makeRefs finished! Refs.saveRefs finished! cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta.idx.fa is generated! cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta.n2g.idx.fa is generated! rsem-parse-alignments cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta cbai_transcriptome_v3.1.fasta.stat/cbai_transcriptome_v3.1.fasta b /gscratch/scrubbed/samwhite/outputs/20201224_cbai_bowtie2_transcriptomes_alignments/cbai_transcriptome_v3.1.fasta.sorted.bam -t 3 -tag XM rsem-parse-alignments: parseIt.cpp:92: void parseIt(SamParser*) [with ReadType = PairedEndReadQ; HitType = PairedEndHit]: Assertion `val == 0 || val == 1 || val == 5' failed. "rsem-parse-alignments cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta cbai_transcriptome_v3.1.fasta.temp/cbai_transcriptome_v3.1.fasta cbai_transcriptome_v3.1.fasta.stat/cbai_transcriptome_v3.1.fasta b /gscratch/scrubbed/samwhite/outputs/20201224_cbai_bowtie2_transcriptomes_alignments/cbai_transcriptome_v3.1.fasta.sorted.bam -t 3 -tag XM" failed! Plase check if you provide correct parameters/options for the pipeline! 

Here’s what the head of the BAM file looks like:

[samwhite@n2233 20201224_cbai_bowtie2_transcriptomes_alignments]$ /gscratch/srlab/programs/samtools-1.10/samtools view cbai_transcriptome_v3.1.fasta.sorted.bam | head A00147:108:HLLJFDMXX:1:1369:3893:6637 163 TRINITY_DN5604_c0_g2_i1 1 42 101M = 81 181 GAAAGAAAAACCGACAGGAGGAATTTCTTTGTTACCAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAA :FFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFF:FFFFFFFFFFFF:FFF:FFFFFFFFFFFFFFFFFFFFFFFF AS:i:-2 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:2G31A66 YS:i:0 YT:Z:CP A00147:121:HLLVMDMXX:1:2159:5674:25786 163 TRINITY_DN5604_c0_g2_i1 4 42 101M = 72 169 AGAAAAACCGACAGGAGGAATTTCTTTGTTAACAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTA FFFFFF:FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP A00147:108:HLLJFDMXX:2:1420:13702:14920 163 TRINITY_DN5604_c0_g2_i1 5 42 101M = 197 293 GAAAAACCGACAGGAGGAATTTCTTTGTTAACAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTAA FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFF AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP A00147:108:HLLJFDMXX:2:1420:13431:15796 163 TRINITY_DN5604_c0_g2_i1 5 42 101M = 197 293 GAAAAACCGACAGGAGGAATTTCTTTGTTAACAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTAA FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP A00147:121:HLLVMDMXX:1:1258:5141:32377 163 TRINITY_DN5604_c0_g2_i1 5 42 101M = 107 203 GAAAAACCGACAGGAGGAATTTCTTTGTTACCAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTAA FFFFF,FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:F:FFFFFFFF AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:30A70 YS:i:0 YT:Z:CP A00147:121:HLLVMDMXX:1:1259:7645:5838 163 TRINITY_DN5604_c0_g2_i1 5 42 101M = 107 203 GAAAAACCGACAGGAGGAATTTCTTTGTTACCAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:30A70 YS:i:0 YT:Z:CP A00147:108:HLLJFDMXX:1:1351:27082:1705 163 TRINITY_DN5604_c0_g2_i1 6 42 101M = 158 253 AAAAACCGACAGGAGGAATTTCTTTGTTAACAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTAAA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF: AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP A00147:108:HLLJFDMXX:1:1475:28926:32706 163 TRINITY_DN5604_c0_g2_i1 6 42 101M = 158 253 AAAAACCGACAGGAGGAATTTCTTTGTTAACAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTAAA FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP A00147:121:HLLVMDMXX:1:2162:31385:26381 163 TRINITY_DN5604_c0_g2_i1 6 42 101M = 158 253 AAAAACCGACAGGAGGAANTTCTTTGTTAACAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTAAA FFFFFFFFFFFFFFFFFF#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFF: AS:i:-1 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:18T82 YS:i:0 YT:Z:CP A00147:121:HLLVMDMXX:2:1425:28745:30639 163 TRINITY_DN5604_c0_g2_i1 7 42 101M = 169 263 AAAACCGACAGGAGGAATTTCTTTGTTAACAACAAAAACTAATATATTTCGCATACCTGACAGACATGGTGACAGCGCCTCTGATGTTCGCCGAATTAAAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF: AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP 

bowtie2 commands to generate the BAM file:

 # Use bowtie2 and paired-end options # Uses settings specified for use with DETONATE # and for paired end reads when using DETONATE. ${programs_array[bowtie2]} \ -x ${transcriptome_name} \ -S ${transcriptome_name}.sam \ --threads ${threads} \ -1 ${R1_list} \ -2 ${R2_list} \ --sensitive \ --dpad 0 \ --gbar 99999999 \ --mp 1,1 \ --np 1 \ --score-min L,0,-0.1 \ --no-mixed \ --no-discordant # Convert SAM to sorted BAM # ${programs_array[samtools_view]} \ -b \ ${transcriptome_name}.sam \ | ${programs_array[samtools_sort]} \ -m ${mem_per_thread} \ --threads ${threads} \ -o ${transcriptome_name}.sorted.bam \ - 

With all of that out of the way, you can find the original post below.