Laura’s Notebook: QuantSeq Library Generation Batch 2

Generated libraries on my second batch of ctenidia RNA samples.

Samples processed, volumes used for RNA and DEPC-treated water, and total RNA used.

Sample order in plate Sample No. [RNA] (ng/ul) Vol RNA used Vol H2O to add ng RNA used
1 343 114.0 3.07 1.93 350
2 345 190.0 1.84 3.16 350
3 303 95.2 3.68 1.32 350
4 346 43.6 5.00 218
5 302 62.4 5.00 312
6 336 94.8 3.69 1.31 350
7 292 29.6 5.00 148
8 NTC1 -B2 5.00 0
9 317 158.0 2.22 2.78 350
10 322 44.6 5.00 223
11 332 65.8 5.00 329
12 334 64.8 5.00 324
13 349 82.0 4.27 0.73 350
14 337 194.0 1.80 3.20 350
15 341 89.6 3.91 1.09 350
16 313 72.4 4.83 0.17 350
17 309 170.0 2.06 2.94 350
18 327 85.2 4.11 0.89 350
19 319 77.6 4.51 0.49 350
20 326 130.0 2.69 2.31 350
21 306 136.0 2.57 2.43 350
22 323 102.0 3.43 1.57 350
23 314 42.2 5.00 211
24 316 146.0 2.40 2.60 350
25 339 77.2 4.53 0.47 350
26 293 39.6 5.00 198
27 329 162.0 2.16 2.84 350
28 296 180.0 1.94 3.06 350

Volumes of solutions needed – I aliquoted volumes into 7 pcr tubes, so I could then add to samples using a multichannel pipette.

Step, Chem. Vol per rxn (uL) Total + 10% or 15% Vol per aliquot (n=7) Vol per sample
Step 3 MM: FS2 9.5 305.9 46 10
Step 3 MM: E1 0.5 16.1
Step 6: RS 5 154 22 5
Step 7: SS1 10 308 44 10
Step 9 MM: SS2 4 128.8 23 5
Step 9 MM: E2 1 32.2

PCR Plate setup

1 2 3 4 5 6 7 8
A 343 345 303 346 302 336 292
B
C NTC1 -B2 317 322 332 334 349 337
D
E 341 313 309 327 319 326 306
F
G 323 314 316 339 293 329 296
H

Notes

  • I worked in 4 rows of 7 (27 samples + 1 NTC).
  • I accidentally used 4.51 uL of sample #326, which is ~585 ug of RNA (exceeds the 500 ug max). I proceeded anyway, and will see if it influences the library quality.
  • Protocol was slightly improved by shortening the amount of time samples sit at 42C at step 2/3 (from 15 mins to ~7 minutes), and I cut the PCR plate to only have 8 of the 12 columns, which freed up space for pre-warming master mix #1 (steps 2/3).
  • I aliquoted 20uL of each sample to new tubes and placed in -80 freezer.

from The Shell Game https://ift.tt/2DSrpOS
via IFTTT

Yaamini’s Notebook: December 2019 Goals

feels

As usual Dwight K. Schrute is right. The end of the quarter is here and I’ve got a few things I want to check off my to-do list before the decade ends.

November Goals Recap

Virginica Gonad Methylation:

  • Found motivation! :tada:
  • Created new figures based on edits

Gigas Gonad Methylation:

  • Presented at the 2019 Graduate Student Symposium

Other:

  • Wrote ocean acidification questions for the midterm
  • Submitted committee meeting paperwork

December Goals:

Virginica Gonad Methylation:

  • Address all edits and send out for another review
  • Clean up repository and add relevant supplementary material
  • Prepare metadata for BCO-DMO submission
  • SUBMIT THAT PAPER!
  • Rejoice.

Gigas Gonad Methylation:

  • Figure out if more samples should be sequenced…maybe using a Swift kit due to low DNA yield?
  • Attempt GO-MWU enrichment and DMG analysis

Other:

  • Finalize sample preparation flowchart for methylation analysis
  • Figure out next steps for C. virginica sperm analysis
  • Write questions for the final
  • Present at Huxley Environmental Speaker Series

Please enable JavaScript to view the comments powered by Disqus.

from the responsible grad student https://ift.tt/365wm2S
via IFTTT

Laura’s Notebook: QuantSeq Library Generation Batch 1

Began my full QuantSeq library prep today. I am processing ctenidia samples first, and since there are 53 samples I’m doing ~half at a time. Today I generated double stranded cDNA for 26 samples + 2 NTC (28 total). I loaded samples onto a PCR plate in 4 rows of 7.

Samples processed, volumes used for RNA and DEPC-treated water, and total RNA used.

cDNA synthesis 12/5/19 # samples + 2 NTC 28 Work in 4 rows of 7
Sample order in plate Sample No. [RNA] (ng/ul) Vol RNA used Vol H2O to add ng RNA used
1 328 156.0 2.24 2.76 350
2 299 50.4 5.00 252
3 301 75.8 4.62 0.38 350
4 342 162.0 2.16 2.84 350
5 331 42.2 5.00 211
6 307 89.4 3.91 1.09 350
7 295 34.8 5.00 174
8 304 200.0 1.75 3.25 350
9 305 75.2 4.65 0.35 350
10 311 158.0 2.22 2.78 350
11 NTC2 – B1 5.00 0
12 298 182.0 1.92 3.08 350
13 348 54.4 5.00 272
14 315 148.0 2.36 2.64 350
15 344 25.0 5.00 125
16 325 180.0 1.94 3.06 350
17 338 81.6 4.29 0.71 350
18 347 69.0 5.00 345
19 312 90.6 3.86 1.14 350
20 321 148.0 2.36 2.64 350
21 333 78.6 4.45 0.55 350
22 291 158.0 2.22 2.78 350
23 308 73.6 4.76 0.24 350
24 NTC1 – B1 5.00 0
25 335 180.0 1.94 3.06 350
26 318 174.0 2.01 2.99 350
27 294 110.0 3.18 1.82 350
28 324 172.0 2.03 2.97 350

Volumes of solutions needed – I aliquoted volumes into 7 pcr tubes, so I could then add to samples using a multichannel pipette.

Step, Chem. Vol per rxn (uL) Total + 15% Vol per aliquot (n=7) Vol per sample
Step 3 MM: FS2 9.5 305.9 46 10
Step 3 MM: E1 0.5 16.1
Step 6: RS 5 161 23 5
Step 7: SS1 10 322 46 10
Step 9 MM: SS2 4 128.8 23 5
Step 9 MM: E2 1 32.2

PCR Plate setup

1 2 3 4 5 6 7 8 9 10 11 12
A 328 299 301 342 331 307 295
B
C 304 305 311 NTC2 – B1 298 348 315
D
E 344 325 338 347 312 321 333
F
G 291 308 NTC1 – B1 335 318 294 324
H

Notes

  • Samples were thawed on wet ice, and vortexed once before use.
  • I loaded the first 3 samples, 328, 299 and 301, onto the PCR plate but then had to wait a few minutes (~3-5) for the rest to thaw.
  • Step #2: held samples at 42C for 14 minutes while preparing master mix. Probably a bit too long.
  • I used a whole PCR Plate, which took up the entire thermocycler space. Next time, I should use partial PCR plates to leave room for a PCR strip to pre-warm the master mix needed for step 3 & 4.
  • The centrifuge gradually cooled as I was using it, which was weird since I didn’t change the temp. I think I need to set temperature to 22C every time I use it, b/c it may default to 4C.
  • I aliquoted 20uL of each sample to new tubes and placed in -80 freezer.

from The Shell Game https://ift.tt/2DWAaqV
via IFTTT

Sam’s Notebook: Data Wrangling – Renaming, Splitting, and Feature Counts of Updated Pgenerosa_v074 GenSAS Merged GFF

In the final GFF from our GenSAS Pgenerosa_v074.a4 annotation , we noticed that there were no repeat motifs/sequences identified on Scaffold 01. The remaining scaffolds all had repeat motifs present on them, so something seemed amiss (see this GitHub Issue for more info).

I ended up contacting GenSAS and it turned out there was a bug on their end that led to this issue:

Taein Lee Nov 26, 2019, 7:27 PM (8 days ago) to me, jhumann

Hi Sam,

Thank you so much for your report. There was a bug and it has been fixed. Your gff3 files has been re-generated.

-Taein From: gensas-admin on behalf of sam white Sent: Tuesday, November 26, 2019 3:45 PM To: gensas-admin; jhumann; taein_lee Subject: [Website feedback] Merged GFF missing repeats on only one chromosome

Sam (https://ift.tt/2LnmNEw) sent a message using the contact form at https://ift.tt/2qkEE7F.

Hi,

I generated a merged GFF after I “published” my annotation. I included RepeatModeler features in the merged GFF.

My genome has 18 chromosomes. All of them except one chromosome (name: PGA_scaffold1__77_contigs__length_89643857) has the expected repeats annotations present.

I looked at the individual RepeatMasker and RepeatModeler jobs, and both of those GFFs identified repeats on PGA_scaffold1__77_contigs__length_89643857.

Would you happen to have any ideas on why PGA_scaffold1__77_contigs__length_89643857 isn’t showing any repeat features in the merged GFF?>

This is for my project Pgenerosa_v074.

Thanks for any insight!

Sam

So, now that I have the updated, final GFF, I want to re-run the GFF splitting into separate feature files, as well as counts and sequence length stats for all features (including repeats).

Everything is documented in this Jupyter Notebook (GitHub):

Sam’s Notebook: PCR – Crassostrea gigas and sikamea Mantle gDNA from Marinelli Shellfish Company

I ran this PCR a couple of times before and, embarrassingly, I had ordered/used the wrong primers.

Well, I ordered the correct universal cytochrome oxidase primers and used those!

SR ID Primer Name Sequence
1739 HC02198 taaacttcagggtgaccaaaaaatca
1738 LCO1490 ggtcaacaaatcataaagatattgg
1736 COCsi546r AAGTAACCTTAATAGATCAGGGAACC
1735 COCgi269r TCGAGGAAATTGCATGTCTGCTACAA

Primers and cycling parameters were taken from this publication:

Universal cytochrome oxidase primers were from this paper:

This is a multiplex PCR, where the HC02198 and LCO1490 primers should amplify any Crassostrea spp. DNA (i.e. a positive control – 697bp) and the other two primers will amplify either C.gigas (Cgi269r – 269bp) or C.sikamea (Csi546r – 546bp).

Master mix calcs:

Component Single Rxn Vol. (uL) Num. Rxns Total Volumes (uL)
DNA 4 NA NA
2x Apex Master Mix 12.5 18 225
HC02198 (100uM) 0.15 18 2.7
LCO1490 (100uM) 0.15 18 2.7
COCgi269r (100uM) 0.1 18 1.8
COCsi546r (100uM) 0.1 18 1.8
H2O 8 18 144
25 Add 21uL to each PCR tube

Cycling params:

95oC for 10mins

30 cycles of:

  • 95oC 1min
  • 51oC 1min
  • 72oC 1min

72oC 10mins

PCR reactions were run on a 1.5% agarose, 1x low TAE gel with ethidium bromide.

Used the GeneRuler DNA Ladder Mix (ThermoFisher) for all gels:

GeneRuler DNA Ladder Mix

Grace’s Notebook: December 2019 Goals

Crab:

  • Submit 6 new pooled samples to NWGC (waiting to hear back about how to submit samples (GitHub Issue: #798))
  • Work on assembling transcriptomes and moving forward with other 4 pooled libraries we currently have

Oyster

  • still need to finish the paper. Should not be difficult- just gotta do it!

Sam’s Notebook: Samples Received – C.bairdi Hemolymph and Tissue in Ethanol from Pam Jensen

Pam Jensen (NOAA) brought by a variety of hemolymph and tissues stored in ethanol to use for DNA sequencing with the new MinION (Oxford Nanopore) to help aid our transcriptomics work.

The box of samples was stored in FTR 26 (underneath the fume hood).

Pam will provide a digitized version of the sample spreadsheet, as well as column name explanations. I’ll add that info here when I receive it.

Image of sample storage box

from Sam’s Notebook https://ift.tt/35CxXwT
via IFTTT