Back story
The Becker Lab has been attempting qPCR for the quantification of Olympia larvae in trap samples that were collected in the Summer of 2013. These samples were passively collected in tube traps that were systematically placed throughout Fidalgo Bay and were originally fixed on site using DMSO in the trap and laster transferred into 50ml centrifuge tubes containing 95% ethanol. The samples have been stored in these same vials since collection for the past 3 years while we were troubleshooting our qPCR quantification methods. Since the DNR study has concluded with successful quantification of bivalve larvae in their pump samples, in March 2016 we have jumped into applying similar methods to finally work on the Fidalgo Bay samples.
Making Standard Curves
We decided to start with the trap samples and have collected hatchery reared Olympia larvae which we are using for our standard curves. These hatchery larvae were treated similar to the trap samples by first exposing the larvae to DMSO and then transferring the larvae into 95% ethanol. To create our standards, larvae were first counted in and placed in 2ml tubes. The standards were counted in sequence as follows: 1, 5, 10, 25, 50. For DNA extraction, we originally wanted to try theThe E.Z.N.A.® Mollusc DNA Kit but upon comparison of the two extraction methods, the ProK method worked just as effectively and had much less cost so we decided to continue with the ProK method. So, the standards underwent DNA extraction using the modified ProK methods that we used in Wight et al 2009 (Solution containing 10mMTris-HCl (pH 8.3), 50mMKCl, 0.5% Tween20, and 6 mAU (Anson units) proteinase K. Incubation time and temperatures18-24 hours incubation at 56C to activate ProK and extract DNA followed by 30min incubation at 95C to denature ProK). For extraction, each standard was dried overnight to evaporate remaining 95% ethanol, 1ml of ProK solution was added to each vial and then incubation occurred. After the denature process, the standards were frozen. Because during this time we were testing the Kit and the ProK method on the SAFS and UWT qPCR machines and running ethanol and DMSO fixed samples (that would represent the pump (ethanol) and trap samples (DMSO) only a single “biological” rep was made for the standards but these reps were run in triplicate as “technical” reps. The samples underwent qPCR using both machines but only the UWT machine results are shown below since we chose this machine to move forward with for analysis. QPCR was preformed using SsoAdvanced Universal Probes Supermix, the Wight et al. 2009 primers and probe: Fwd: TTTGAGTTTTGCCGGTTTCTC; Rev: ATGCCCGGTCTACTGAACG; Probe: ACAGGTTGAACTGTTTACCCGCCGT (5′ 6-FAM™ – 3′ Black Hole Quencher 1 100nmoles). and molecular water at a total reaction volume of 20ul. Combination of raw data, averages, and standard deviations for this standard curve run are below. We also plugged the equation in to our averages to see how an “unknown” would fit into our curve. For these “unknown” samples we used a 4th replicate of the 5, 25, and 50 standards.
Include |
Color |
Pos |
Name |
Cp |
Concentration |
Standard |
Average Cp |
StDev Cp |
x=2.713^((y-28.171)/-1.575) |
TRUE |
128 |
A10 |
Sample 10 |
27.68 |
3.52E-01 |
ProK |
1 |
28.09 |
0.601082357 |
1.052668685 |
TRUE |
128 |
A11 |
Sample 10 |
27.81 |
3.23E-01 |
ProK |
1 |
|
|
|
TRUE |
128 |
A12 |
Sample 10 |
28.78 |
1.76E-01 |
ProK |
1 |
|
|
|
TRUE |
128 |
B10 |
Sample 22 |
25.81 |
1.14E+00 |
ProK |
5 |
25.75333333 |
0.115902258 |
4.627611593 |
TRUE |
128 |
|
Sample 22 |
25.62 |
1.29E+00 |
ProK |
5 |
|
|
|
TRUE |
128 |
B12 |
Sample 22 |
25.83 |
1.13E+00 |
ProK |
5 |
|
|
|
TRUE |
128 |
C10 |
Sample 34 |
24.66 |
2.35E+00 |
ProK |
10 |
24.62333333 |
0.040414519 |
9.469780813 |
TRUE |
128 |
C11 |
Sample 34 |
24.58 |
2.47E+00 |
ProK |
10 |
|
|
|
TRUE |
128 |
C12 |
Sample 34 |
24.63 |
2.40E+00 |
ProK |
10 |
|
|
|
TRUE |
128 |
D10 |
Sample 46 |
22.87 |
7.27E+00 |
ProK |
25 |
22.98666667 |
0.106926766 |
26.71534401 |
TRUE |
128 |
D11 |
Sample 46 |
23.01 |
6.64E+00 |
ProK |
25 |
|
|
|
TRUE |
128 |
D12 |
Sample 46 |
23.08 |
6.39E+00 |
ProK |
25 |
|
|
|
TRUE |
128 |
E10 |
Sample 58 |
21.61 |
1.61E+01 |
ProK |
50 |
21.52333333 |
0.232450712 |
67.52727175 |
TRUE |
128 |
E11 |
Sample 58 |
21.7 |
1.52E+01 |
ProK |
50 |
|
|
|
TRUE |
128 |
E12 |
Sample 58 |
21.26 |
2.01E+01 |
ProK |
50 |
|
|
|
TRUE |
255 |
F10 |
Sample 70 |
24.82 |
2.13E+00 |
ProK |
UNKNOWN5 |
25.14 |
0.45254834 |
6.82574481 |
TRUE |
255 |
F11 |
Sample 70 |
25.46 |
1.43E+00 |
ProK |
UNKNOWN5 |
|
|
TRUE |
255 |
G10 |
Sample 82 |
22.83 |
7.44E+00 |
ProK |
UNKNOWN25 |
22.905 |
0.106066017 |
28.13428907 |
TRUE |
255 |
G11 |
Sample 82 |
22.98 |
6.77E+00 |
ProK |
UNKNOWN25 |
|
|
TRUE |
255 |
H10 |
Sample 94 |
21.52 |
1.70E+01 |
ProK |
UNKNOWN50 |
21.6 |
0.113137085 |
64.3250393 |

We decided that 50 larvae standard was too much for the machine to read and still be accurate so we decided to reduce the max of our curve to 25 and put two more points into it so our next standard curve would be 1, 5, 10, 15, 20 and 25.
We felt confident with our results and decisions, our ProK method was still working we had a plan of action for our curve, the ProK method worked fine with DMSO fixed larvae and decided to move forward with analyzing the first batch of Fidalgo Bay samples. To start analysis we selected a single site with in our sample base and run all of the time series for that summer collection period. Previous visual identification of larvae in the samples identified the S1A site area as a highly productive site with numerous larvae so we chose this site to start our analysis.
All samples for this site (there were 74 of them) were split in half using the Beaker technique which involves pouring the 50ml samples back and forth between two 50 ml tubes and then taken an even half of the sample which after the pouring is considered a homogenous sample. After the samples were split in half, half was kept for future analysis and the other half was pipetted into a 2ml tube to collect all plankton in the sample. The remaining ethanol in the samples was visually checked to ensure no larvae was left behind. These samples were then removed of any remaining ethanol and dried overnight. The following day the samples underwent DNA extraction using the modified ProK method. I also redid the standard curve at this time using the new curve points (1, 5, 10, 15, 20 and 25). We did 56 the first day and the remaining samples the next since we were limited to how many we could do at once using the heat block. There was also an issue with the ProK solution that we were using. At first we had enough of the ThermoScientific Brand ProK but then had to make more and upon that realization, I noticed that the ProK that I had ordered was a VWR brand. Thinking that there should be no difference, continued on using this ProK for the digestions.
When the digestion was complete, the samples were run on qPCR using the UWT machine and the new standards. These results are below. I think the image shows enough…

The above image shows the first of three plates that were run to complete the SIA sample subset for Fidalgo Bay 2013. Only the standards show amplification . All the green dots (with exception to 10, 11 and 12 on row H) contained sample in it. Because all three plates showed similar results (with only the standard curve showing and very little Oly DNA amplification at a reliable Ct we were concerned that the samples may have degraded, that there were no Oly larvae in the samples or that the extraction method didn’t work.
To see if there were any Oly larvae in the samples at all, 8 samples that underwent visual confirmation in 2013 of any bivalve larvae present in them were selected and visually identified to clam and Oly larvae present. Below is a table of the eight samples inspected and the results of identification. The “Tube #” column denote the vial tube that we use to id the sample, the “Sample ID” column is the actual sample name and date. We also checked the pH.
Tube # |
Sample ID |
Oly Larvae present |
pH |
Notes |
28 |
S1A_S_7/11-18/13_2 |
yes, lots of bivalves some oly |
4 |
1 270um oly |
39 |
S1A_B_7/11-18/13_2 |
0 |
4 |
1 400um clam, 1 clam, clam |
50 |
S1A_S_7/11-18/13_3 |
yes, lots of bivalves some oly |
4 |
oly1, 2 250ul oly, a few more oly and a few clams |
61 |
S1A_B_7/11-18/13_3 |
yes |
4 |
300um oly, 1 clam 2 clams 1 2230um oly, 1 275um oly, 1 clam |
68 |
S1A_S_5/10-16/13_2 |
0 |
4 |
clam330um*, clam 400 350um clam* |
69 |
S1A_B_5/2-10/13_2 |
0 |
4 |
1 clam 300um |
72 |
S1A_S_5/10-16/13_3 |
0 |
4 |
1 clam 350um* |
73 |
S1A_B_5/2-10/13_3 |
0 |
4 |
na |
Upon visual identification of 8 samples that were checked visually for any bivalve larvae, I was able to identify that there were Oly larvae in some of the samples, so there should be Oly DNA in the extractions if it worked and if the DNA hasn’t degraded over the years in storage.
To test degradation of DNA in the samples we preformed PCR on all the samples using the same oly primers used in qPCR. No images here are listed because no PCR product showed after PCR was done on all 74 samples. PCR also didn’t work on the standard curves however, which was confusing since the standards worked with qPCR.
Because PCR using the Oly primers didn’t work, we wanted to see if there was ANY DNA detectable in the samples. We used the nano drop at UWT to determine concentration and purity of DNA in the samples and below is the table of those results.
Full sample name |
Sample # abreviation |
Absorbance (A260 10mm) |
Purity Ratio (A260/A280) |
Concentration (ng/ul) |
S1A_S_5/10-16/13_1 |
1 |
1.529 |
0.97 |
76.5 |
S1A_S_5/16-23/13_1 |
2 |
1.983 |
1.1 |
99.2 |
S1A_S_5/23-30/13_1 |
3 |
3.141 |
1.1 |
157.1 |
S1A_S_5/30-6/6/13_1 |
4 |
1.909 |
1.04 |
95.4 |
S1A_S_6/6-13/13_1 |
5 |
2.539 |
1.07 |
127 |
S1A_S_6/13-20/13_1 |
6 |
2.38 |
1.15 |
119 |
S1A_S_6/20-27/13_1 |
7 |
3.818 |
1.12 |
190.9 |
S1A_S_6/27-7/3/13_1 |
8 |
1.427 |
0.98 |
71.4 |
S1A_S_7/3-11/13_1 |
9 |
3.892 |
1.1 |
194.6 |
S1A_S_7/18-25/13_1 |
10 |
4.361 |
1.14 |
218.1 |
S1A_B_5/16-23/13_1 |
11 |
1.618 |
1.02 |
80.9 |
S1A_B_5/23-30/13_1 |
12 |
2.949 |
1.22 |
147.5 |
S1A_B_5/30-6/6/13_1 |
13 |
1.443 |
0.99 |
72.1 |
S1A_B_6/6-13/13_1 |
14 |
1.563 |
0.97 |
78.2 |
S1A_B_6/13-20/13_1 |
15 |
1.503 |
1.06 |
75.1 |
S1A_B_6/20-27/13_1 |
16 |
3.131 |
1.1 |
156.6 |
S1A_B_6/27-7/3/13_1 |
17 |
2.243 |
1.02 |
112.1 |
S1A_B_7/3-11/13_1 |
18 |
2.597 |
1.13 |
129.8 |
S1A_B_7/18-25/13_1 |
19 |
2.477 |
1.13 |
123.9 |
S1A_S_5/16-23/13_2 |
20 |
2.063 |
1.11 |
103.2 |
S1A_S_5/23-30/13_2 |
21 |
3.148 |
1.09 |
157.4 |
S1A_S_5/30-6/6/13_2 |
22 |
1.743 |
1.03 |
87.2 |
S1A_S_6/6-13/13_2 |
23 |
2.51 |
1.03 |
125.5 |
S1A_S_6/13-20/13_2 |
24 |
1.409 |
1.02 |
70.4 |
S1A_S_6/20-27/13_2 |
25 |
2.455 |
1.04 |
122.8 |
S1A_S_6/27-7/3/13_2 |
26 |
2.849 |
1.06 |
142.5 |
S1A_S_7/3-11/13_2 |
27 |
4.438 |
1.1 |
221.9 |
S1A_S_7/11-18/13_2 |
28 |
2.733 |
1.1 |
136.6 |
S1A_S_7/18-25/13_2 |
29 |
0.723 |
0.85 |
36.2 |
S1A_S_7/25-8/1/13_2 |
30 |
3.134 |
1.14 |
156.7 |
S1A_B_5/16-23/13_2 |
31 |
1.393 |
1.06 |
69.7 |
S1A_B_5/23-30/13_2 |
32 |
2.95 |
1.26 |
147.5 |
S1A_B_5/30-6/6/13_2 |
33 |
1.106 |
0.94 |
55.3 |
S1A_B_6/6-13/13_2 |
34 |
1.447 |
1.03 |
72.3 |
S1A_B_6/13-20/13_2 |
35 |
1.185 |
0.96 |
59.3 |
S1A_B_6/20-27/13_2 |
36 |
2.317 |
1.1 |
115.9 |
S1A_B_6/27-7/3/13_2 |
37 |
1.173 |
0.99 |
58.7 |
S1A_B_7/3-11/13_2 |
38 |
2.729 |
1.06 |
136.4 |
S1A_B_7/11-18/13_2 |
39 |
2.914 |
1.11 |
145.7 |
S1A_B_7/18-25/13_2 |
40 |
0.764 |
0.86 |
38.2 |
S1A_B_7/25-8/1/13_2 |
41 |
2.259 |
1.17 |
113 |
S1A_S_5/16-23/13_3 |
42 |
1.64 |
1.03 |
82 |
S1A_S_5/23-30/13_3 |
43 |
4.001 |
1.11 |
200 |
S1A_S_5/30-6/6/13_3 |
44 |
1.874 |
0.96 |
93.7 |
S1A_S_6/6-13/13_3 |
45 |
3 |
1.04 |
150 |
S1A_S_6/13-20/13_3 |
46 |
2.273 |
1.11 |
113.6 |
S1A_S_6/20-27/13_3 |
47 |
3.984 |
1.07 |
199.2 |
S1A_S_6/27-7/3/13_3 |
48 |
2.395 |
1.07 |
119.8 |
S1A_S_7/3-11/13_3 |
49 |
2.782 |
1.06 |
139.1 |
S1A_S_7/11-18/13_3 |
50 |
2.337 |
1.06 |
116.8 |
S1A_S_7/18-25/13_3 |
51 |
4.031 |
1.13 |
201.5 |
S1A_S_7/25-8/1/13_3 |
52 |
1.662 |
1.01 |
83.1 |
S1A_B_5/16-23/13_3 |
53 |
1.47 |
1.09 |
73.5 |
S1A_B_5/23-30/13_3 |
54 |
2.118 |
1.17 |
105.9 |
S1A_B_5/30-6/6/13_3 |
55 |
1.068 |
0.94 |
53.4 |
S1A_B_6/6-13/13_3 |
56 |
1.696 |
0.99 |
84.8 |
S1A_B_6/13-20/13_3 |
57 |
1.101 |
0.96 |
55.1 |
S1A_B_6/20-27/13_3 |
58 |
1.824 |
1.05 |
91.2 |
S1A_B_6/27-7/3/13_3 |
59 |
1.204 |
1.03 |
60.2 |
S1A_B_7/3-11/13_3 |
60 |
2.041 |
1.11 |
102.1 |
S1A_B_7/11-18/13_3 |
61 |
2.063 |
1.12 |
103.2 |
S1A_B_7/18-25/13_3 |
62 |
2.83 |
1.13 |
141.5 |
S1A_B_7/25-8/1/13_3 |
63 |
1.103 |
0.98 |
55.1 |
S1A_S_5/2-10/13_1 |
64 |
1.554 |
1.03 |
77.7 |
S1A_B_5/2-10/13_1 |
65 |
1.383 |
1.08 |
69.2 |
S1A_B_5/10-16/13_1 |
66 |
0.942 |
0.92 |
47.1 |
S1A_S_5/2-10/13_2 |
67 |
1.345 |
1.01 |
67.3 |
S1A_S_5/10-16/13_2 |
68 |
1.122 |
1.07 |
56.1 |
S1A_B_5/2-10/13_2 |
69 |
1.023 |
0.96 |
51.1 |
S1A_B_5/10-16/13_2 |
70 |
0.775 |
0.9 |
38.8 |
S1A_S_5/2-10/13_3 |
71 |
1.633 |
1.05 |
81.7 |
S1A_S_5/10-16/13_3 |
72 |
1.243 |
1.04 |
62.1 |
S1A_B_5/2-10/13_3 |
73 |
1.219 |
1.01 |
60.9 |
S1A_B_5/10-16/13_3 |
74 |
1.113 |
1.02 |
55.6 |
After using the nano drop we were concerned that the purity ratios weren’t good enough since after consulting with other professors we would want a purity of around 1.50 (A260/A280) and we just overall didn’t know if these numbers were good or not. We asked Steven and Sam and Sam suggested that we use a Qubit Fluorometer to test the concentrations of the samples instead. Below are those results. For the Qubit, we read the samples using the Broad Range samples and reagents and used a 20ul sample and 180ul of the reagents and the Qubit tubes. We added the 180 reagent mixture of dye and buffer (1:199) and added the 20ul sample after the BR solution was added. We vortexed the samples then centrifuged down to eliminate bubbles and allowed to sit for 2 min before taking the reading.
Full sample name |
Sample # abbreviation |
Qubit 06272016_[DNA] (ng/microliter)_sample |
S1A_S_5/10-16/13_1 |
1 |
0.212 |
S1A_S_5/16-23/13_1 |
2 |
0.369 |
S1A_S_5/23-30/13_1 |
3 |
1.23 |
S1A_S_5/30-6/6/13_1 |
4 |
0.526 |
S1A_S_6/6-13/13_1 |
5 |
0.86 |
S1A_S_6/13-20/13_1 |
6 |
0.708 |
S1A_S_6/20-27/13_1 |
7 |
1.67 |
S1A_S_6/27-7/3/13_1 |
8 |
0.15 |
S1A_S_7/3-11/13_1 |
9 |
1.35 |
S1A_S_7/18-25/13_1 |
10 |
1.94 |
S1A_B_5/16-23/13_1 |
11 |
0.271 |
S1A_B_5/23-30/13_1 |
12 |
0.971 |
S1A_B_5/30-6/6/13_1 |
13 |
0.257 |
S1A_B_6/6-13/13_1 |
14 |
0.281 |
S1A_B_6/13-20/13_1 |
15 |
0.259 |
S1A_B_6/20-27/13_1 |
16 |
1.17 |
S1A_B_6/27-7/3/13_1 |
17 |
0.684 |
S1A_B_7/3-11/13_1 |
18 |
0.691 |
S1A_B_7/18-25/13_1 |
19 |
0.757 |
S1A_S_5/16-23/13_2 |
20 |
0.527 |
S1A_S_5/23-30/13_2 |
21 |
1.2 |
S1A_S_5/30-6/6/13_2 |
22 |
0.418 |
S1A_S_6/6-13/13_2 |
23 |
0.933 |
S1A_S_6/13-20/13_2 |
24 |
0.256 |
S1A_S_6/20-27/13_2 |
25 |
0.936 |
S1A_S_6/27-7/3/13_2 |
26 |
0.922 |
S1A_S_7/3-11/13_2 |
27 |
1.75 |
S1A_S_7/11-18/13_2 |
28 |
1.04 |
S1A_S_7/18-25/13_2 |
29 |
LOW |
S1A_S_7/25-8/1/13_2 |
30 |
0.969 |
S1A_B_5/16-23/13_2 |
31 |
0.226 |
S1A_B_5/23-30/13_2 |
32 |
0.82 |
S1A_B_5/30-6/6/13_2 |
33 |
0.178 |
S1A_B_6/6-13/13_2 |
34 |
0.257 |
S1A_B_6/13-20/13_2 |
35 |
0.109 |
S1A_B_6/20-27/13_2 |
36 |
0.644 |
S1A_B_6/27-7/3/13_2 |
37 |
0.114 |
S1A_B_7/3-11/13_2 |
38 |
0.595 |
S1A_B_7/11-18/13_2 |
39 |
0.835 |
S1A_B_7/18-25/13_2 |
40 |
LOW |
S1A_B_7/25-8/1/13_2 |
41 |
0.477 |
S1A_S_5/16-23/13_3 |
42 |
0.282 |
S1A_S_5/23-30/13_3 |
43 |
1.58 |
S1A_S_5/30-6/6/13_3 |
44 |
0.5 |
S1A_S_6/6-13/13_3 |
45 |
1.27 |
S1A_S_6/13-20/13_3 |
46 |
0.602 |
S1A_S_6/20-27/13_3 |
47 |
1.48 |
S1A_S_6/27-7/3/13_3 |
48 |
0.785 |
S1A_S_7/3-11/13_3 |
49 |
0.921 |
S1A_S_7/11-18/13_3 |
50 |
0.783 |
S1A_S_7/18-25/13_3 |
51 |
1.83 |
S1A_S_7/25-8/1/13_3 |
52 |
0.594 |
S1A_B_5/16-23/13_3 |
53 |
0.251 |
S1A_B_5/23-30/13_3 |
54 |
0.484 |
S1A_B_5/30-6/6/13_3 |
55 |
LOW |
S1A_B_6/6-13/13_3 |
56 |
0.303 |
S1A_B_6/13-20/13_3 |
57 |
0.113 |
S1A_B_6/20-27/13_3 |
58 |
0.533 |
S1A_B_6/27-7/3/13_3 |
59 |
LOW |
S1A_B_7/3-11/13_3 |
60 |
0.401 |
S1A_B_7/11-18/13_3 |
61 |
0.412 |
S1A_B_7/18-25/13_3 |
62 |
0.886 |
S1A_B_7/25-8/1/13_3 |
63 |
LOW |
S1A_S_5/2-10/13_1 |
64 |
0.467 |
S1A_B_5/2-10/13_1 |
65 |
0.29 |
S1A_B_5/10-16/13_1 |
66 |
0.126 |
S1A_S_5/2-10/13_2 |
67 |
0.361 |
S1A_S_5/10-16/13_2 |
68 |
0.174 |
S1A_B_5/2-10/13_2 |
69 |
0.134 |
S1A_B_5/10-16/13_2 |
70 |
LOW |
S1A_S_5/2-10/13_3 |
71 |
0.335 |
S1A_S_5/10-16/13_3 |
72 |
0.219 |
S1A_B_5/2-10/13_3 |
73 |
0.248 |
S1A_B_5/10-16/13_3 |
74 |
0.13 |
1olysc |
SC |
LOW |
5olysc |
SC |
LOW |
10olysc |
SC |
LOW |
15olysc |
SC |
LOW |
20olysc |
SC |
LOW |
25olysc |
SC |
LOW |
Now we were more confused because the readings were super low and some (including the standard curves which we knew to have DNA in them from qPCR data) showed too low of a concentration to read. On top of that confusion, we also noticed that the nano drop results were quite different than the Qubit ones, so which do we believe. And what is the min DNA concentration that we can use when quantifying larvae using qPCR? We put these questions on hold for a moment and wondered is somehow the change in ProK brand may have interfered with DNA extraction and then qPCR.
Testing the Two Brands of ProK used to extract DNA from samples
To test the different brands, I first contacted the manufacturer VWR to see if they had more information on the product since there is no literature that comes with it or on line about what is in it and to ask them why the VWR brand can be stored in the fridge where as the ThermoScientific (TS) brand needs to be frozen. They said that they are basically the same and the only main difference between them is that the TS brand is from a recombinant protein and the VWR brand is made for molecular biology studies and is a native protein. I decided to make two different curves using each brand ProK solution and test them to see if there is a difference. I digested them the same using methods as I did with the Fidalgo 2013 samples from the Wight et al 2009 paper and made the standards using 1, 5, 10, 15, 20 and 25 larvae. After this was done I used them for PCR with no results for PCR (At this point I thought we had PCR method issues cause we should be getting some kind of amplified product using Oly primers). At this time I also ordered the Eukaryotic primer sets that Sam offered I use if we wanted to test the samples for ANY DNA present.
Knowing that the standards worked previously with qPCR I decided to test the ProK extractions using qPCR and see if there was a noticeable difference. below are the results from that in table and graph form.
Raw Data
Experiment: 07052016_TS and VWD standard curves Selected Filter: FAM (465-510) Using Abs Quant Fit Points Analysis |
|
|
Include |
Color |
Pos |
Brand ProK |
Name |
Cp |
Concentration |
Standard |
Status |
TRUE |
128 |
A1 |
TS |
Sample 1 |
25.11 |
1.07E+00 |
1 |
|
TRUE |
128 |
A2 |
TS |
Sample 1 |
25.15 |
1.04E+00 |
1 |
|
TRUE |
128 |
A3 |
TS |
Sample 1 |
25.46 |
8.11E-01 |
1 |
|
TRUE |
128 |
A4 |
TS |
Sample 4 |
23.96 |
2.68E+00 |
5 |
|
TRUE |
128 |
A5 |
TS |
Sample 4 |
23.37 |
4.24E+00 |
5 |
|
TRUE |
128 |
A6 |
TS |
Sample 4 |
23.73 |
3.19E+00 |
5 |
|
TRUE |
128 |
A7 |
VWR |
Sample 7 |
25.34 |
8.94E-01 |
1 |
|
TRUE |
128 |
A8 |
VWR |
Sample 7 |
25.17 |
1.02E+00 |
1 |
|
TRUE |
128 |
A9 |
VWR |
Sample 7 |
25.08 |
1.10E+00 |
1 |
|
TRUE |
128 |
A10 |
VWR |
Sample 10 |
23.18 |
4.94E+00 |
5 |
|
TRUE |
128 |
A11 |
VWR |
Sample 10 |
23.07 |
5.38E+00 |
5 |
|
TRUE |
128 |
A12 |
VWR |
Sample 10 |
22.97 |
5.85E+00 |
5 |
|
TRUE |
128 |
B1 |
TS |
Sample 13 |
22.24 |
1.04E+01 |
10 |
|
TRUE |
128 |
B2 |
TS |
Sample 13 |
22.12 |
1.14E+01 |
10 |
|
TRUE |
128 |
B3 |
TS |
Sample 13 |
22.03 |
1.23E+01 |
10 |
|
TRUE |
128 |
B4 |
TS |
Sample 16 |
22.01 |
1.25E+01 |
15 |
|
TRUE |
128 |
B5 |
TS |
Sample 16 |
22.16 |
1.11E+01 |
15 |
|
TRUE |
128 |
B6 |
TS |
Sample 16 |
22.41 |
9.06E+00 |
15 |
|
TRUE |
128 |
B7 |
VWR |
Sample 19 |
22.17 |
1.09E+01 |
10 |
|
TRUE |
128 |
B8 |
VWR |
Sample 19 |
22.25 |
1.03E+01 |
10 |
|
TRUE |
128 |
B9 |
VWR |
Sample 19 |
22.2 |
1.07E+01 |
10 |
|
TRUE |
128 |
B10 |
VWR |
Sample 22 |
21.34 |
2.11E+01 |
15 |
|
TRUE |
128 |
B11 |
VWR |
Sample 22 |
21.43 |
1.98E+01 |
15 |
|
TRUE |
128 |
B12 |
VWR |
Sample 22 |
21.06 |
2.65E+01 |
15 |
|
TRUE |
128 |
C1 |
TS |
Sample 25 |
22.14 |
1.12E+01 |
20 |
|
TRUE |
128 |
C2 |
TS |
Sample 25 |
22.16 |
1.11E+01 |
20 |
|
TRUE |
128 |
C3 |
TS |
Sample 25 |
22.27 |
1.02E+01 |
20 |
|
TRUE |
128 |
C4 |
TS |
Sample 28 |
21.32 |
2.15E+01 |
25 |
|
TRUE |
128 |
C5 |
TS |
Sample 28 |
20.89 |
3.01E+01 |
25 |
|
TRUE |
128 |
C6 |
TS |
Sample 28 |
20.85 |
3.13E+01 |
25 |
|
TRUE |
128 |
C7 |
VWR |
Sample 31 |
21.28 |
2.22E+01 |
20 |
|
TRUE |
128 |
C8 |
VWR |
Sample 31 |
21.34 |
2.12E+01 |
20 |
|
TRUE |
128 |
C9 |
VWR |
Sample 31 |
21.33 |
2.13E+01 |
20 |
|
TRUE |
128 |
C10 |
VWR |
Sample 34 |
21.23 |
2.31E+01 |
25 |
|
TRUE |
128 |
C11 |
VWR |
Sample 34 |
20.38 |
4.52E+01 |
25 |
|
TRUE |
65280 |
C12 |
|
Sample 36 |
|
|
0 |
|
TRUE |
65280 |
D1 |
NTC |
Sample 37 |
|
|
0 |
|
TRUE |
65280 |
D2 |
NTC |
Sample 37 |
|
|
0 |
|
TRUE |
65280 |
D3 |
NTC |
Sample 37 |
|
|
0 |
|
TRUE |
255 |
D4 |
TC |
Sample 40 |
13.92 |
7.52E+03 |
0 |
E – Extrapolated concentration in standard curve |
|
|
|
|
|
|
|
0 |
|
Averages from data
ThermoScientific ProK Solution |
Standard |
Average |
StDev |
1 |
25.24 |
0.191572441 |
5 |
23.68666667 |
0.297377426 |
10 |
22.13 |
0.105356538 |
15 |
22.19333333 |
0.202072594 |
20 |
22.19 |
0.07 |
25 |
21.02 |
0.260576284 |
VWR ProK Solution |
|
Standard |
Average |
StDev |
1 |
25.19666667 |
0.132035349 |
5 |
23.07333333 |
0.105039675 |
10 |
22.20666667 |
0.040414519 |
15 |
21.27666667 |
0.192959409 |
20 |
21.31666667 |
0.032145503 |
25 |
20.805 |
0.601040764 |
Graphs of curves



Upon comparison, there didn’t seem to be much of a difference between the two ProK brands, if anything the VWR brand seems more sensitive, but that could just be that “biological” rep. I also used the Qubit to determine concentration of DNA in these samples to see if there was a major difference there, and there was not. Below are the results.
Brand ProK |
Standard |
Qubit 06302016_[DNA] (ng/ul)_sample |
Qubit 06302016_[Tube]sample ug/mL |
Notes |
Thermo Scientific |
1 |
Low |
Low |
Thermo Scientific |
1 |
Low |
Low |
Thermo Scientific |
1 |
Low |
Low |
Thermo Scientific |
5 |
Low |
Low |
Thermo Scientific |
5 |
Low |
Low |
Thermo Scientific |
5 |
Low |
Low |
Thermo Scientific |
10 |
5.20E-03 |
5.20E-04 |
Thermo Scientific |
10 |
5.10E-03 |
5.10E-04 |
Thermo Scientific |
10 |
5.00E-03 |
5.00E-04 |
Thermo Scientific |
10 |
Low |
Low |
read 4th time accident |
Thermo Scientific |
15 |
Low |
Low |
Thermo Scientific |
15 |
Low |
Low |
Thermo Scientific |
15 |
Low |
Low |
Thermo Scientific |
20 |
5.20E-03 |
5.20E-04 |
Thermo Scientific |
20 |
5.10E-03 |
5.10E-04 |
Thermo Scientific |
20 |
5.10E-03 |
5.10E-04 |
Thermo Scientific |
25 |
6.70E-03 |
6.70E-04 |
Thermo Scientific |
25 |
6.30E-03 |
6.30E-04 |
Thermo Scientific |
25 |
6.30E-03 |
6.30E-04 |
VWR |
1 |
Low |
Low |
VWR |
1 |
Low |
Low |
VWR |
1 |
Low |
Low |
VWR |
5 |
Low |
Low |
VWR |
5 |
Low |
Low |
VWR |
5 |
Low |
Low |
VWR |
10 |
Low |
Low |
VWR |
10 |
Low |
Low |
VWR |
10 |
Low |
Low |
VWR |
15 |
Low |
Low |
VWR |
15 |
6.90E-03 |
6.90E-04 |
VWR |
15 |
6.60E-03 |
6.60E-04 |
VWR |
20 |
5.60E-03 |
5.60E-04 |
VWR |
20 |
5.50E-03 |
5.50E-04 |
VWR |
20 |
5.20E-03 |
5.20E-04 |
VWR |
25 |
9.30E-03 |
9.30E-04 |
VWR |
25 |
9.10E-03 |
9.10E-04 |
VWR |
25 |
9.30E-03 |
9.30E-04 |
Many of the samples from each of the different standard curves showed too low of concentration of DNA to detect using the Broad Range spectrum.
I feel like the ProK brand isn’t the issue we are having, it must be more to do with wether or not we have DNA in the samples and if there is enough of it to reliable detect and use with qPCR. Decided to try precipitating the DNA in these standards and see if we can concentrate the DNA and get detectable concentrations of DNA after precipitation.
Precipitating DNA of two ProK Brand Standards
To precipitate DNA in the standards, I followed similar methods that we use to isolate DNA with the DNAzol method when applied to adult bivalves. I added 1ml 100% ethanol to each tube inverted 8 times and allowed to sit upright for three minutes. When done centrifuged for 5 minutes at 5000G to sediment DNA into a pellet at the bottom of the tube.When finished I didn’t see the pellet so to be sure that it was all sedimented at the bottom re-centrifuged for another 5 min at 5000G.When centrifugation was completed, pipetted out supernatant as much as possible with out disturbing the bottom of the tube where the pellet would have formed, but at this time it’s still not visible. Discarded supernatant. For Step 4 (DNAzol protocol), DNA wash, of the DNAzol protocol, I figured we didn’t necessarily need to do the part where there was a 70:30 DNAzol:Ethanol mix which we did before (I would have done with ProK if I chose this route). Instead used just 75% ethanol for DNA wash and only used 500ul for it. Pipetted 500ul of 75% ethanol into each standard and suspended pellet by inversion and finger vortexing. Allowed to sit for 3 minutes then centrifuged for 5min at 5000G. After centrifuging the supernatant was discarded. Repeated this step once.When finished, tried to pipette out as much ethanol as possible, also tried to allow to air dry for approx 30 minutes.To resuspend pellet, 150ul of molecular grade water was added to each standard and resuspended by finger vortexing and spun down to isolate liquid. Took samples to read DNA concentration using the Qubit. Below are the results comparing the original Qubit readings before precipitation and the Qubit results after precipitating the DNA in the standards.
Comparing DNA concentration before (06302016) and after (07072016) precipitating DNA in the standards (below).
Brand ProK |
Standard |
Qubit 07072016_[DNA] (ng/microliter)_sample |
Qubit 06302016_[DNA] (ng/microliter)_sample |
Thermo Scientific |
1 |
6.50E-03 |
Low |
Thermo Scientific |
1 |
6.40E-03 |
Low |
Thermo Scientific |
1 |
6.40E-03 |
Low |
Thermo Scientific |
5 |
6.80E-03 |
Low |
Thermo Scientific |
5 |
6.60E-03 |
Low |
Thermo Scientific |
5 |
6.70E-03 |
Low |
Thermo Scientific |
10 |
7.40E-03 |
5.20E-03 |
Thermo Scientific |
10 |
7.30E-03 |
5.10E-03 |
Thermo Scientific |
10 |
7.20E-03 |
5.00E-03 |
Thermo Scientific |
15 |
7.10E-03 |
Low |
Thermo Scientific |
15 |
7.00E-03 |
Low |
Thermo Scientific |
15 |
6.90E-03 |
Low |
Thermo Scientific |
20 |
9.60E-03 |
5.20E-03 |
Thermo Scientific |
20 |
9.50E-03 |
5.10E-03 |
Thermo Scientific |
20 |
9.40E-03 |
5.10E-03 |
Thermo Scientific |
25 |
8.80E-03 |
6.70E-03 |
Thermo Scientific |
25 |
8.60E-03 |
6.30E-03 |
Thermo Scientific |
25 |
8.60E-03 |
6.30E-03 |
VWR |
1 |
7.30E-03 |
Low |
VWR |
1 |
7.20E-03 |
Low |
VWR |
1 |
7.20E-03 |
Low |
VWR |
5 |
6.50E-03 |
Low |
VWR |
5 |
6.50E-03 |
Low |
VWR |
5 |
6.40E-03 |
Low |
VWR |
10 |
7.10E-03 |
Low |
VWR |
10 |
6.90E-03 |
Low |
VWR |
10 |
6.90E-03 |
Low |
VWR |
15 |
7.30E-03 |
Low |
VWR |
15 |
6.30E-03 |
6.90E-03 |
VWR |
15 |
7.20E-03 |
6.60E-03 |
VWR |
20 |
8.10E-03 |
5.60E-03 |
VWR |
20 |
8.00E-03 |
5.50E-03 |
VWR |
20 |
7.60E-03 |
5.20E-03 |
VWR |
25 |
1.00E-02 |
9.30E-03 |
VWR |
25 |
9.70E-03 |
9.10E-03 |
VWR |
25 |
9.50E-03 |
9.30E-03 |
Precipitating the standards appeared to have worked so now we wanted to use them with qPCR and PCR.
qPCR on precipitated standards
Using the precipitated DNA standards we prepared qPCR reactions in reps of 4 for each ProK brand so that we could measure DNA concentration before qPCR, after qPCR , have qPCR data and finally run the resulting end reactions on PCR to see if we get an amplified PCR product (first step in testing our PCR methods).
Aliquoting primers and probe
- .5ml of molecular grade water was poured into a labeled eppendorf tube.
- Oly primers and probe were aliquoted at 100ul of 10mM aliquots by first adding 90ul of molecular grade water and 10ul of each respective primer or probe at starting concentration of 100mM.
- After making each aliquot, they were finger vortexed and centrifuged down to isolate liquid.
Preparing Master mix
- Master mix was made with the following ingredients and volumes.
|
vol pr rxn |
Total rxns |
vol*#rxns |
10% Error |
total vol needed |
Mix |
10 |
55 |
550 |
55 |
605 |
FWD |
0.8 |
55 |
44 |
4.4 |
48.4 |
REV |
0.8 |
55 |
44 |
4.4 |
48.4 |
Probe |
0.4 |
55 |
22 |
2.2 |
24.2 |
Water |
6 |
55 |
330 |
33 |
363 |
Template |
2 |
|
|
|
|
- To make the master mix, SsoAdvanced super mix was added first followed by the Fwd and Rev primers, Probe, and lastly with molecular grade water.
- After combining ingredients, the mix was inverted multiple times then centrifuged down to isolate solution.
Plate set up
- Used the following layout for the plate set up.
- Note that columns 1-4 were used for the ThermoScientific brand of ProK standards sand columns 5-8 were used for the standards digested in VWR brand ProK.
|
TS Standards Columns 1-4 |
VWR Standards Columns 5-6 |
|
|
|
|
|
|
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
A |
1OlySC |
1OlySC |
1OlySC |
1OlySC |
1OlySC |
1OlySC |
1OlySC |
1OlySC |
B |
5OlySC |
5OlySC |
5OlySC |
5OlySC |
5OlySC |
5OlySC |
5OlySC |
5OlySC |
C |
10OlySC |
10OlySC |
10OlySC |
10OlySC |
10OlySC |
10OlySC |
10OlySC |
10OlySC |
D |
15OlySC |
15OlySC |
15OlySC |
15OlySC |
15OlySC |
15OlySC |
15OlySC |
15OlySC |
E |
20OlySC |
20OlySC |
20OlySC |
20OlySC |
20OlySC |
20OlySC |
20OlySC |
20OlySC |
F |
25OlySC |
25OlySC |
25OlySC |
25OlySC |
25OlySC |
25OlySC |
25OlySC |
25OlySC |
G |
NTC |
NTC |
NTC |
H |
|
- Reactions were pipetted in groups based on proK brand (made all TS standard reactions first, then all VWR reactions).
- Uncapped columns 1-4.
- Pipetted 18ul of master mix into each well being used. Had to do slowly and carefully in a pouring type action so could avoid as many bubbles as possible.
- Pipetted 2ul of the template and added to each respective well. This was added directly above the master mix liquid so formed a drop off the pipette tib then slowly touched to the master mix liquid so contact was made and exchange of liquid from tip to master mix reaction was made. This was done to avoid as many bubbles as possible.
- After the template was added, used the template tip to mix reaction by slowly pipetting up and down carefully to avoid bubbles.
- Lids were capped and then uncapped VWR lids.
- VWS standard reactions were made same as TS standards.
- NTC was made using molecular water as the template.
Running Qubit (before qPCR)
Before taking the plate to 336 where the qPCR machine is I prepared the Qubit reactions.
I wanted to make enough of the reagent for both before and after qPCR Qubit reactions so made a total enough to read 30 samples ( Only needed 26 since also reading a NTC but this gives a little room for error).
Used the High Sensitive reagents since so far we are only able to detect DNA using the HIGH SENSITIVITY setting.
Used the following ingredients to make Qubit reagents.
Component for Reagent |
Standard Volume (uL) per sample |
number of samples |
Volumn (uL) fo ALL |
Dye |
1 |
30 |
30 |
Buffer |
199 |
30 |
5970 |
- Made reagent by first adding the Buffer and then the Dye to a 15ml centrifuge tube.
- Inverted tube to mix solution well.
- Labeled 26 Qubit specific tubes with respective standard and added a P to denote that these were readings for after Precipitating the DNA from the original extraction and added either a qPCR before or after to the tube to denote if it was a reaction from before or after qpcr so it will let me know which is which at a later day.
- These labels were only labeled on top not the side which would cause a mis reading of fluorescence.
- Added 180ul of reagent to each tube.
- Took the 4th replicate (columns 4 and 8) and added 20ul of reaction in those wells (which was all of the reaction) and added to each labeled Qubit tube matching labeled tube with reaction in well using the plate diagram above as a guide.
- Vortexed for 5 seconds and centrifuged down until no bubbles remained in the reactions.
- Allowed to stand upright for 2 minutes before reading the initial DNA concentration (fluorescence) of the reactions.
- After the two minutes was done, I turned the Qubit and selected dsDNA High sensitivity 20ul sample volume.
- Placed the first tube in the tube slot closed the lid and hit read sample. Started with P1OlySCTSbefore and moved through all of the TS standards then started with the VWR standards 1-25.
- Read the standard three times before moving onto the next standard.
- A value of LOW indicates that the concentration of DNA in the sample was too low to detect.
Brand ProK |
Standard |
Qubit before qPCR 07112016_[DNA] (ng/ml)_sample |
ng/ul |
Thermo Scientific |
1 |
862 |
0.862 |
Thermo Scientific |
1 |
861 |
0.861 |
Thermo Scientific |
1 |
860 |
0.86 |
Thermo Scientific |
5 |
822 |
0.822 |
Thermo Scientific |
5 |
822 |
0.822 |
Thermo Scientific |
5 |
821 |
0.821 |
Thermo Scientific |
10 |
803 |
0.803 |
Thermo Scientific |
10 |
802 |
0.802 |
Thermo Scientific |
10 |
801 |
0.801 |
Thermo Scientific |
15 |
861 |
0.861 |
Thermo Scientific |
15 |
860 |
0.86 |
Thermo Scientific |
15 |
859 |
0.859 |
Thermo Scientific |
20 |
LOW |
#VALUE! |
Thermo Scientific |
20 |
LOW |
#VALUE! |
Thermo Scientific |
20 |
LOW |
#VALUE! |
Thermo Scientific |
25 |
836 |
0.836 |
Thermo Scientific |
25 |
836 |
0.836 |
Thermo Scientific |
25 |
834 |
0.834 |
VWR |
1 |
874 |
0.874 |
VWR |
1 |
865 |
0.865 |
VWR |
1 |
861 |
0.861 |
VWR |
5 |
849 |
0.849 |
VWR |
5 |
848 |
0.848 |
VWR |
5 |
846 |
0.846 |
VWR |
10 |
877 |
0.877 |
VWR |
10 |
875 |
0.875 |
VWR |
10 |
874 |
0.874 |
VWR |
15 |
841 |
0.841 |
VWR |
15 |
840 |
0.84 |
VWR |
15 |
838 |
0.838 |
VWR |
20 |
863 |
0.863 |
VWR |
20 |
861 |
0.861 |
VWR |
20 |
858 |
0.858 |
VWR |
25 |
886 |
0.886 |
VWR |
25 |
882 |
0.882 |
VWR |
25 |
879 |
0.879 |
NTC |
NTC |
849 |
0.849 |
NTC |
NTC |
845 |
0.845 |
NTC |
NTC |
843 |
0.843 |
Running qPCR
- Made sure all of the lids were capped and wiped them with a kim wipe.
- Placed the plate in the machine and ht new experiment from existing template.
- Selected Fidalgo 2013Template as the program to run which uses the parameters listed below for the cycles.
1) Incubate 95C 2min 30sec
2) 95C 30sec
3) 60C for 50sec
4) Plate read
5) Repeat steps 2-4 39 more times
6) Program end
- Hit run
- After run was performed, noticed that some of the lids popped off during qPCR which may have caused evaporation in some of the samples.
- The samples where this occurred are Column 7 row a, b, and c. These are the reactions that will be used for running the Qubit so they may have a higher concentration in it than normal or not enough sample to really be the 20ul that I am trying to run with.
qPCR Raw data
Experiment: 07112016_TSProK_VWRProK_TEST Selected Filter: FAM (465-510) |
|
Include |
Color |
Pos |
Name |
Cp |
Concentration |
Standard |
Standard |
TRUE |
128 |
A1 |
Sample 1 |
30.51 |
TS1 |
1 |
TRUE |
128 |
A2 |
Sample 1 |
30.3 |
TS1 |
1 |
TRUE |
128 |
A3 |
Sample 1 |
29 |
TS1 |
1 |
TRUE |
128 |
A4 |
Sample 1 |
|
|
QB1_TS1 |
1 |
TRUE |
128 |
A5 |
Sample 5 |
30.62 |
VWR1 |
1 |
TRUE |
128 |
A6 |
Sample 5 |
30.83 |
VWR1 |
1 |
TRUE |
128 |
A7 |
Sample 5 |
30.58 |
VWR1 |
1 |
TRUE |
128 |
A8 |
Sample 5 |
|
|
QB1_VWR1 |
1 |
TRUE |
65280 |
A9 |
Sample 9 |
|
|
BLANK |
0 |
TRUE |
65280 |
A10 |
Sample 9 |
|
|
BLANK |
0 |
TRUE |
65280 |
A11 |
Sample 9 |
|
|
BLANK |
0 |
TRUE |
65280 |
A12 |
Sample 9 |
|
|
BLANK |
0 |
TRUE |
128 |
B1 |
Sample 13 |
27.53 |
TS5 |
5 |
TRUE |
128 |
B2 |
Sample 13 |
27.29 |
TS5 |
5 |
TRUE |
128 |
B3 |
Sample 13 |
27.45 |
TS5 |
5 |
TRUE |
128 |
B4 |
Sample 13 |
|
|
QB1_TS5 |
5 |
TRUE |
128 |
B5 |
Sample 17 |
27.8 |
VWR5 |
5 |
TRUE |
128 |
B6 |
Sample 17 |
27.88 |
VWR5 |
5 |
TRUE |
128 |
B7 |
Sample 17 |
27.79 |
VWR5 |
5 |
TRUE |
128 |
B8 |
Sample 17 |
|
|
QB1_VWR5 |
5 |
TRUE |
65280 |
B9 |
Sample 21 |
|
|
BLANK |
0 |
TRUE |
65280 |
B10 |
Sample 22 |
|
|
BLANK |
0 |
TRUE |
65280 |
B11 |
Sample 23 |
|
|
BLANK |
0 |
TRUE |
65280 |
B12 |
Sample 24 |
|
|
BLANK |
0 |
TRUE |
128 |
C1 |
Sample 25 |
25.64 |
TS10 |
10 |
TRUE |
128 |
C2 |
Sample 25 |
25.41 |
TS10 |
10 |
TRUE |
128 |
C3 |
Sample 25 |
TS10 |
10 |
TRUE |
128 |
C4 |
Sample 25 |
|
|
QB1_TS10 |
10 |
TRUE |
128 |
C5 |
Sample 29 |
26.55 |
VWR10 |
10 |
TRUE |
128 |
C6 |
Sample 29 |
26.5 |
VWR10 |
10 |
TRUE |
128 |
C7 |
Sample 29 |
26.46 |
VWR10 |
10 |
TRUE |
128 |
C8 |
Sample 29 |
29.96 |
|
QB1_VWR10 |
10 |
TRUE |
65280 |
C9 |
Sample 33 |
|
|
BLANK |
0 |
TRUE |
65280 |
C10 |
Sample 34 |
|
|
BLANK |
0 |
TRUE |
65280 |
C11 |
Sample 35 |
|
|
BLANK |
0 |
TRUE |
65280 |
C12 |
Sample 36 |
|
|
BLANK |
0 |
TRUE |
128 |
D1 |
Sample 37 |
25.65 |
TS15 |
15 |
TRUE |
128 |
D2 |
Sample 37 |
25.72 |
TS15 |
15 |
TRUE |
128 |
D3 |
Sample 37 |
25.87 |
TS15 |
15 |
TRUE |
128 |
D4 |
Sample 37 |
|
|
QB1_TS15 |
15 |
TRUE |
128 |
D5 |
Sample 41 |
25.87 |
VWR15 |
15 |
TRUE |
128 |
D6 |
Sample 41 |
25.61 |
VWR15 |
15 |
TRUE |
128 |
D7 |
Sample 41 |
25.93 |
VWR15 |
15 |
TRUE |
128 |
D8 |
Sample 41 |
30.78 |
|
QB1_VWR15 |
15 |
TRUE |
65280 |
D9 |
Sample 45 |
|
|
BLANK |
0 |
TRUE |
65280 |
D10 |
Sample 46 |
|
|
BLANK |
0 |
TRUE |
65280 |
D11 |
Sample 47 |
|
|
BLANK |
0 |
TRUE |
65280 |
D12 |
Sample 48 |
|
|
BLANK |
0 |
TRUE |
128 |
E1 |
Sample 49 |
23.97 |
TS20 |
20 |
TRUE |
128 |
E2 |
Sample 49 |
24.16 |
TS20 |
20 |
TRUE |
128 |
E3 |
Sample 49 |
24.01 |
TS20 |
20 |
TRUE |
128 |
E4 |
Sample 49 |
23.92 |
|
QB1_TS20 |
20 |
TRUE |
128 |
E5 |
Sample 53 |
24.68 |
VWR20 |
20 |
TRUE |
128 |
E6 |
Sample 53 |
24.18 |
VWR20 |
20 |
TRUE |
128 |
E7 |
Sample 53 |
24.66 |
VWR20 |
20 |
TRUE |
128 |
E8 |
Sample 53 |
30.98 |
|
QB1_VWR20 |
20 |
TRUE |
65280 |
E9 |
Sample 57 |
|
|
BLANK |
0 |
TRUE |
65280 |
E10 |
Sample 58 |
|
|
BLANK |
0 |
TRUE |
65280 |
E11 |
Sample 59 |
|
|
BLANK |
0 |
TRUE |
65280 |
E12 |
Sample 60 |
|
|
BLANK |
0 |
TRUE |
128 |
F1 |
Sample 61 |
23.76 |
TS25 |
25 |
TRUE |
128 |
F2 |
Sample 61 |
23.59 |
TS25 |
25 |
TRUE |
128 |
F3 |
Sample 61 |
24.16 |
TS25 |
25 |
TRUE |
128 |
F4 |
Sample 61 |
|
|
QB1_TS25 |
25 |
TRUE |
128 |
F5 |
Sample 65 |
23.4 |
VWR25 |
25 |
TRUE |
128 |
F6 |
Sample 65 |
22.98 |
VWR25 |
25 |
TRUE |
128 |
F7 |
Sample 65 |
22.77 |
VWR25 |
25 |
TRUE |
128 |
F8 |
Sample 65 |
26.3 |
|
QB1_VWR25 |
25 |
TRUE |
65280 |
F9 |
Sample 69 |
|
|
BLANK |
0 |
TRUE |
65280 |
F10 |
Sample 70 |
|
|
BLANK |
0 |
TRUE |
65280 |
F11 |
Sample 71 |
|
|
BLANK |
0 |
TRUE |
65280 |
F12 |
Sample 72 |
|
|
BLANK |
0 |
TRUE |
65280 |
G1 |
Sample 73 |
|
|
NTC |
0 |
TRUE |
65280 |
G2 |
Sample 73 |
|
|
NTC |
0 |
TRUE |
65280 |
G3 |
Sample 73 |
|
|
NTC |
0 |
Averages
TS standard curve averages |
Standard |
TS Average |
TS StDev |
1 |
30.67666667 |
0.134288247 |
5 |
27.82333333 |
0.049328829 |
10 |
26.50333333 |
0.045092498 |
15 |
25.80333333 |
0.170098011 |
20 |
24.50666667 |
0.283078317 |
25 |
23.05 |
0.320780299 |
VWR standard curve averages |
Standard |
VWR Average |
VWR StDev |
1 |
29.93666667 |
0.817944578 |
5 |
27.42333333 |
0.122202019 |
10 |
25.525 |
0.16263456 |
15 |
25.74666667 |
0.112398102 |
20 |
24.04666667 |
0.100166528 |
25 |
23.83666667 |
0.292631737 |

After precipitating the DNA and running with qPCR on the samples and comparing them to the previous run when DNA was not precipitated it appears that the samples amplified later in the run. But there still seems no difference between the two proK brands (orange represents the VWR brand and the blue represents the ThermoScientific brand). VWR brand still seems to be more sensitive with this run which was also seen with the previous run.
Running Qubit (after qPCR)
- After qPCR was finished, took out plate and used reactions in wells associated with column 3 and 7 to apply to Qubit to get final concentration of DNA after running qPCR.
- Added 20 ul of these reactions to the associated labeled tubes and read the samples following the same steps as done on reading them before qPCR.
- There was not enough volume to reach the 20ul in samples Column 7 A and B but ran with what they had anyway.
Brand ProK |
Standard |
Qubit after qPCR 07112016_[DNA] (ng/ml)_sample |
ng/ul |
Thermo Scientific |
1 |
4860 |
4.86 |
Thermo Scientific |
1 |
4850 |
4.85 |
Thermo Scientific |
1 |
4840 |
4.84 |
Thermo Scientific |
5 |
4930 |
4.93 |
Thermo Scientific |
5 |
4930 |
4.93 |
Thermo Scientific |
5 |
4920 |
4.92 |
Thermo Scientific |
10 |
887 |
0.887 |
Thermo Scientific |
10 |
884 |
0.884 |
Thermo Scientific |
10 |
882 |
0.882 |
Thermo Scientific |
15 |
4960 |
4.96 |
Thermo Scientific |
15 |
4960 |
4.96 |
Thermo Scientific |
15 |
4960 |
4.96 |
Thermo Scientific |
20 |
4990 |
4.99 |
Thermo Scientific |
20 |
4980 |
4.98 |
Thermo Scientific |
20 |
4980 |
4.98 |
Thermo Scientific |
25 |
4940 |
4.94 |
Thermo Scientific |
25 |
4940 |
4.94 |
Thermo Scientific |
25 |
4940 |
4.94 |
VWR |
1 |
4670 |
4.67 |
VWR |
1 |
4660 |
4.66 |
VWR |
1 |
4660 |
4.66 |
VWR |
5 |
4990 |
4.99 |
VWR |
5 |
4980 |
4.98 |
VWR |
5 |
4980 |
4.98 |
VWR |
10 |
4830 |
4.83 |
VWR |
10 |
4830 |
4.83 |
VWR |
10 |
4830 |
4.83 |
VWR |
15 |
5000 |
5 |
VWR |
15 |
5000 |
5 |
VWR |
15 |
5000 |
5 |
VWR |
20 |
4870 |
4.87 |
VWR |
20 |
4870 |
4.87 |
VWR |
20 |
4870 |
4.87 |
VWR |
25 |
5100 |
5.1 |
VWR |
25 |
5100 |
5.1 |
VWR |
25 |
5100 |
5.1 |
NTC |
NTC |
905 |
0.905 |
NTC |
NTC |
905 |
0.905 |
NTC |
NTC |
904 |
0.904 |
- Determined the % increase of DNA concentration by calculating
- (([final]-[initial])/[final]) *100
- Percent increase in DNA concentration is listed below.
- Almost all of the reactions had >80 percent increase in concentration after qPCR.
Brand ProK |
Standard |
% increase |
Thermo Scientific |
1 |
82.26337449 |
Thermo Scientific |
1 |
82.24742268 |
Thermo Scientific |
1 |
82.23140496 |
Thermo Scientific |
5 |
83.32657201 |
Thermo Scientific |
5 |
83.32657201 |
Thermo Scientific |
5 |
83.31300813 |
Thermo Scientific |
10 |
9.470124014 |
Thermo Scientific |
10 |
9.2760181 |
Thermo Scientific |
10 |
9.183673469 |
Thermo Scientific |
15 |
82.64112903 |
Thermo Scientific |
15 |
82.66129032 |
Thermo Scientific |
15 |
82.68145161 |
Thermo Scientific |
20 |
#VALUE! |
Thermo Scientific |
20 |
#VALUE! |
Thermo Scientific |
20 |
#VALUE! |
Thermo Scientific |
25 |
83.07692308 |
Thermo Scientific |
25 |
83.07692308 |
Thermo Scientific |
25 |
83.11740891 |
VWR |
1 |
81.28479657 |
VWR |
1 |
81.43776824 |
VWR |
1 |
81.52360515 |
VWR |
5 |
82.98597194 |
VWR |
5 |
82.97188755 |
VWR |
5 |
83.01204819 |
VWR |
10 |
81.8426501 |
VWR |
10 |
81.88405797 |
VWR |
10 |
81.9047619 |
VWR |
15 |
83.18 |
VWR |
15 |
83.2 |
VWR |
15 |
83.24 |
VWR |
20 |
82.27926078 |
VWR |
20 |
82.32032854 |
VWR |
20 |
82.38193018 |
VWR |
25 |
82.62745098 |
VWR |
25 |
82.70588235 |
VWR |
25 |
82.76470588 |
NTC |
NTC |
6.187845304 |
NTC |
NTC |
6.629834254 |
NTC |
NTC |
6.747787611 |
PCR was also preformed on the remaining qPCR replicates. to do this we added the use of loading dye. To run gel, independently placed two 1.2% agarose gel made with 1X TAE buffer into 2 gel boxes and poured 1X TAE buffer into gel box over molds until the mold was completely covered. Pipetted out 10ul of 1000bp low range ladder and added to first well. Used loading dye 1:1 with each sample so that there was a total of 10ul for each well. Pipetted 5ul of each reaction into a PCR plate in the same position as original plate layout so to not confuse myself. To the 5ul sample added 5ul of loading dye. Pipetted up and down to mix. Pipetted out the resulting 10ul reactions and added to respective well as diagramed above. Ran electrophoresis at 100V for 30 min. We were able to see clear amplified product on the resulting gels.
Gel #15 (below) ThermoScientific Precipitated qPCR ProK Gel
Reactions showing from L –> R as follows:
Row 1- L NTC 1SC 1SC 5SC 5SC 10SC 10SC 15SC 15SC 20SC 20SC
Row 2- L NTC 25SC 25SC
Amplified product detected in all reactions with exception to NTC.

Gel #16 (below) VWR Precipitated qPCR ProK Gel
Reactions showing from L –> R as follows:
Row 1- L NTC 1SC 1SC 5SC 5SC 10SC 10SC 15SC 15SC 20SC 20SC
Row 2- L NTC 25SC 25SC
Amplified product detected after using electrophoresis on qPCR reactions with exception to NTC.
We also ran the eukaryotic primers (EukA CTGGTTGATCCTGCCAG; EukB TGATCCTTCYGCAGGTTC) that Sam suggested on the 8 Fidalgo Bay samples that we identified should have DNA in them. When these gels were run all showed some light amplification including the NTC which indicated that we had contamination. These will be run again. However, electrophoresis is definitely working as we can see using the qPCR reactions so the PCR methods must be having issues at the thermocycler stage. Maybe this is what the issue is when running PCR to test DNA presence in our Fidalgo Bay samples. Testing the PCR method was the next problem worked out.
Testing PCR settings
Making 1.2% agarose gels using 1X TAE buffer for PCR
- Want three gels so going to make a total of 450ml of agarose so that there wil be more than enough to run with.
- Need 450ml of 1XTAE Buffer
- Need 5.4g of Agarose chem
- Need 45ul of Ethedium Bromide
- Cleaned gel molds and comb rows with ultra pure water and put molds in gel lanes in prep for making the gels.
- triple rinsed a 100ml graduated cylinder and 1000ml Erlenmeyer flask.
- Added 400 ml of the 1X TAE buffer to the flask.
- Measured out the agarose powder (actual mass= 5.404g) onto a weighboat in a tared three place balance.
- Poured dry chemical into flask with the buffer in it.
- Measured out final volume (50ml) of 1X TAE buffer and used it to rinse the weigh boat.
- Swirled solution and microwaved for 4 minutes, until the agarose completely dissolved into buffer.
- Pipetted out 45ul of ethedium bromide and aded to solution.
- Poured solution into three molds and used pipette tip to push all bubbles to the side of the mold or pop them so they wouldn’t interfere with electrophoresis.
- Allowed molds to cool.
Thermocycler test
Setting up Thermocyclers
- Changed presets on Thermocycler 2 to so that the cycles are as listed below which would allow match of qPCR settings:
Thermocycler 2 was set so the the cycles were as listed below:
95C for 10minutes |
95C for 2min 30sec (X40) |
60C for 20sec (X40) |
60C for 30sec (X40) |
72C for 2minutes |
4C for holding |
Thermocycler 1 was set so the the cycles were as listed below:
95oC-10min |
40 cycles of: |
95oC-20sec |
65oC-20sec |
72oC-30sec |
72oC-2min |
4oC- Hold For Ever |
- For the step (65oC-20sec) this deviated from where Sam had us running which was 55C for 20 seconds. Changed this setting back to 55C. This could have been the issue all along.
- Thermocycler 1 now reads so that the cycler parameters are:
Thermocycler 1 |
95oC-10min |
40 cycles of: |
95oC-20sec |
55oC-20sec |
72oC-30sec |
72oC-2min |
4oC- Hold For Ever |
Master mix prep
- We will be using the same Precipitated TS brand standard curve samples that we used during qPCR.
- Decided to just run the TS standards to limit the amount of ingredients we need to use . Also decided to do this since so far each brand has had minimal differences so either one should work for this test.
- NTC will be prepared with molecular water.
- 18TC sample that contains adult Oly DNA as a positive control.
- The samples will be run in duplicate with exception to the TC which will be a single reaction on each gel.
- Total of 30 samples will be prepared and run.
- Master mix was prepared using the following volumes.
Ingredient |
Standard Volume (ul) |
Number of samples (#) |
V*# |
(V*#)*10%Error |
Total Volume (ul) |
Master mix |
12.5 |
30 |
375 |
37.5 |
412.5 |
Fwd Primer |
0.5 |
30 |
15 |
1.5 |
16.5 |
Rev Primer |
0.5 |
30 |
15 |
1.5 |
16.5 |
Water |
9.5 |
30 |
285 |
28.5 |
313.5 |
- Master mix was prepped by first adding the 2X green taq mix, then FWD and REV primers which were already aliquoted from 07112016 qPCR run and then water was added to complete the mix.
- The mix was inverted to mix and centrifuged down to isolate solution to the bottom of eppendorf tube.
- The standards were thawed finger vortexed to homogonize and then centrifuged down to isolate the sample.
- 8strip tubes were labeled and prepared for PCR by adding 23ul of master mic followed by 2ul of respective sample then centrifuged down.
- The samples were placed in their respective thermocyclers and ran each program.
Electrophoresis
Placed a gel into two gel boxes and filled gel box with 1X TAE buffer until the solution just covered the gels.
Added 10ul of ladder to the first well and then 10 ul of respective reaction the the remaining wells that were to be used using the following diagram:
Gel #17 |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
Row 1 |
L |
N |
TS1OlySC |
TS1OlySC |
TS10OlySC |
TS10OlySC |
TS15OlySC |
TS15OlySC |
TS20OlySC |
TS20OlySC |
TS25OlySC |
TS25OlySC |
Row 2 |
L |
N |
TS5OlySC |
TS5OlySC |
18tc |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gel #18 |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
Row 1 |
L |
N |
TS1OlySC |
TS1OlySC |
TS10OlySC |
TS10OlySC |
TS15OlySC |
TS15OlySC |
TS20OlySC |
TS20OlySC |
TS25OlySC |
TS25OlySC |
Row 2 |
L |
N |
TS5OlySC |
TS5OlySC |
18tc |
Ran electrophoresis at 100V for 30 min. The results, below, show both methods worked just fine which we did not get when we ran these standards before on PCR. It could be that correcting Thermocycler 1 to be 55C instead of 65C made the difference in getting PCR working. It could also be that precipitating the DNA made things work out. Because the PCR issue seems to be fixed now and because when we ran the eukaryotic primers before there was contamination, we decided to run them again and make sure everything is completely sterile. We also wanted to test the Oly primers on the same samples.
Running PCR on Eukaryotic primers and Oly primers
Used Fidalgo Bay samples that we have been working with that contained Oly larvae in them (by visual confirmation). These samples are listed below- the numbers associated with the samples denote where they are in the layouts for the gels below.
Tube # |
Sample ID |
28 |
S1A_S_7/11-18/13_2 |
39 |
S1A_B_7/11-18/13_2 |
50 |
S1A_S_7/11-18/13_3 |
61 |
S1A_B_7/11-18/13_3 |
68 |
S1A_S_5/10-16/13_2 |
69 |
S1A_B_5/2-10/13_2 |
72 |
S1A_S_5/10-16/13_3 |
73 |
S1A_B_5/2-10/13_3 |
Running Oly primers on Fidalgo Bay samples
- Will run these samples in duplicate
- Will also run 2 NTC using molecular water as template.
- Will run the precipitated TS25OlySC sample as a positive control.
- Total of 20 samples will be run on a single gel.
- Using the volumes below I made the master mix:
Ingredient |
Standard Volume (ul) |
Number of samples (#) |
V*# |
(V*#)*10%Error |
Total Volume (ul) |
Master mix |
12.5 |
20 |
250 |
25 |
275 |
Fwd Primer |
0.5 |
20 |
10 |
1 |
11 |
Rev Primer |
0.5 |
20 |
10 |
1 |
11 |
Water |
9.5 |
20 |
190 |
19 |
209 |
- To make the mix I first added the master mixfollowed by the same FEW and REV primers that I used in the above thermocycler test (there was still some left over from the previous aliquot from 07112016 qPCR run) and finished the solution by adding molecular water.
- Inverted the solution to mix well and centrifuged to isolate the liquid to the bottom of the tube. The samples were already thawed from being set out prior to starting the mix (used the 20ul aliquots that were made previously form the original samples).
- Set out and labeled 8-strip PCR tubes and caps.
- Added 23ul of the master mix to each tube followed by 2u of the respective sample.
- Centrifuged down and set in Thermocycler 1 along with the eukaryotic samples to undergo PCR.
Eukaryotic primers on Fidalgo Bay samples
- For these samples we will also test them using the loading dye as well as with out just to make sure that adding a loading dye isn’t the issue we are having when we aren’t seeing amplification.
- Again, since we’re working with a very sensitive primer, I sterilized every utensil I would need for the procedure by placing under the UV light for 30 minutes. Since, at the end of 30 minutes this will be a sterile work space too, I will continue the rest of the work under the tank. Materials included:
- Each 8 strip tube I would need (3) along with each of their tops (3).
- Each strip was stood up and left unopened and exposed to the UV light, while each strip lid was left upside-down so that the inside of the tube would remain sterile.
- Pipettes (just to be overcautious)
- Pipette tips (just to be overcautious)
- Left in their containers with the lid closed.
- 10ul, 100ul, and 1000ul
- 2ml tube for nuclease free water (used for aliquoting primers and making the mix)
- Left opened and stood up.
- 2ml tube for final master mix
- Left opened and stood up.
- Two 2ml tubes for the forward and reverse primers after aliquoting.
- Left opened and stood up.
- Tip waste, (just to be overcautious).
- Aliquoted the primers, knowing that their initial concentration was 100uM, I needed the final concentration to be 10uM, and that I would need 15ul final for each (I did the calculations for the master mix below first to see how much of each primer I would need, then I rounded to account for error).
- 100uM*X=10uM*15ul
- X=1.5ul of primer added to 13.5ul of water (15-1.5=13.5)
- Created a master mix using the following calculations:
- 8 samples (28, 39, 50, 61, 68, 69, 72, 73) duplicated on the gel is 16 slots, in addition to 2 ladders, 2NTCs, and 2TC (sample 18 DNR), there will be a total of 22 samples.
-
Ingredient |
Stnd Vol (ul) |
# samples |
vol*# samples |
10% error |
Total+10% error |
Green Mix |
12.5 |
22 |
275 |
27.5 |
302.5 |
FWD |
0.5 |
22 |
11 |
1.1 |
12.1 |
REV |
0.5 |
22 |
11 |
1.1 |
12.1 |
Water |
9.5 |
22 |
209 |
20.9 |
229.9 |
- Added each in the order they appear to a 2ml tube and inverted to make sure it was homogenous.
- Pipette 23ul of master mix into each tube on the 8-strip tubes, followed by 2ul of the assigned template (whether a sample or water for NTC/TC).
-
- Before pipetting, the master mix or each sample was inverted or finger vortexed.
Thermocycler parameters are as listed below.
95oC-10min |
40 cycles of: |
95oC-20sec |
55oC-20sec |
72oC-30sec |
72oC-2min |
4oC- Hold For Ever |
Prep of three more gels for electrophoresis
- I measured 300ml of 1.0 TBE in a graduated cylinder (100ml at a time) and poured into a volumetric flask (leaving some out to wash out the weighboat of agarose powder).
- I then measured 3.6g (actual weight 3.601g) of agarose powder (1.2g per 100ml) and poured into the volumetric flask, rinsing the weighboat with the extra buffer solution.
- Put a kimwipe into the mouth of the Erlenmeyer flask and microwaved for 1 minute, 1 minute, and then every 10 seconds until all the agarose was dissolved, making sure to swirl the flask with each set.
- Made sure to wear autoclave gloves and held away from face.
- Monitored the mixture closely, making sure it did not boil over.
- Once done cooking, I added syberSAFE dye (1:10,000=10ul per 100ml).
- After letting cool for about 5 minutes, I poured the gel into two gel trays and then continued to let it cool into form.
Electrophoresis
- Once the thermocycler was done, the strip tubes were taken out and loaded onto the gels according to the layout below:
- Gel layout for the samples that I’ve done here will be as follows:
Gel #19 |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
Row 1 |
L |
N |
28 |
28 |
39 |
39 |
50 |
50 |
61 |
61 |
68 |
68 |
Row 2 |
L |
N |
69 |
69 |
72 |
72 |
73 |
73 |
TS25OlySC |
TS25OlySC |
-
Gel W/OUT DYE |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
TOP |
L |
TC |
NTC |
28 |
28 |
39 |
39 |
50 |
50 |
61 |
61 |
BOTTOM |
L |
TC |
NTC |
68 |
68 |
69 |
69 |
72 |
72 |
73 |
73 |
Gel W/ DYE |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
TOP |
L |
TC |
NTC |
28 |
28 |
39 |
39 |
50 |
50 |
61 |
61 |
BOTTOM |
L |
TC |
NTC |
68 |
68 |
69 |
69 |
72 |
72 |
73 |
73 |
- For the set with loading dye, I did a 1:4 ratio:
- Pipetted 7.5ul of each sample into a new tube strip tube, then 2.5ul of loading dye into the sample tube (total 10ul). THEN loaded into the gel wells.
- For the regular gels without loading dye being added, 10ul of the sample was pipetted into the well.
- Gels were set to run for 30 minutes at 100V.
Results
Gel #19 (below) Fidalgo Bay samples Run with Oly Primers
Reactions showing from L –> R as follows:
Row 1- L NTC 28 28 39 39 50 50 61 61 68 68
Row 2- L NTC 69 69 72 72 73 73 TSOly25SC TSOly25SC
Amplified product detected only on the TSOly25SC

Gel (below) Fidalgo Bay samples WITH dye test run with eukaryotic primers
Reactions showing from L –> R as follows:
Row 1- L TC NTC 28 28 39 39 59 59 61 61
Row 2- L TC NTC 68 68 69 69 72 72 73 73
No amplified product shows- only ladder ; no amplified product for the TC either though
Gel (below) Fidalgo Bay samples WITHOUT dye test run with eukaryotic primers
Reactions showing from L –> R as follows:
Row 1- L TC NTC 28 28 39 39 59 59 61 61
Row 2- L TC NTC 68 68 69 69 72 72 73 73
No amplified product shows- only ladder; this includes the TC
In summary, I’m not sure the eukaryotic primers are working since they aren’t amplifying on the template control which is DNA from an adult Olympia oyster. It could be that that sample no longer has DNA in it, but I don’t think this is likely. We could try again and use one of the precipitated standards as a TC to test the primers. Either that or the samples have degraded and we need to move onto hand counts.
Precipitating the DNA in the standards seemed to work well. I was thinking that that would be the next step but I want to test it with the 8 samples that we’ve been using for tests first.
We could also try extracting DNA from the other half of the original samples and using the DNA kit for extraction.