Author Archives: michellenegron

michellenegron 9:17 PM on October 10, 2016  

Becker Lab qPCR troubleshooting update

Backstory

The Becker lab is currently attempting to use qPCR to quantify Olympia oyster larvae in two sets of environmental samples. One set is from Fidalgo Bay 2013 research where the samples were collected using passive traps and are fairly sediment rich. The second set is from Megan’s samples where were collected by pumping and were taken in Summer 2015 in Dyes Inlet and Fidalgo Bay. To reference each of these studies I will call the first set Trap samples and the second set Pump samples, referencing the method of sample collection which is the major distinguishing factor between the samples.

Trap samples

Overview- We have been using a modified ProK method for DNA extraction of the trap samples however there have been questions on whether or not the samples may still even contain enough genetic material to run qPCR. In a previous discussion with the Roberts Lab I indicated that we have been doing a series of PCR experiments to test the presence of DNA using eukaryotic and bacteria primers. We were able to see a faint band in a subset of trap samples that were previously extracted using the modified ProK method, so we concluded that there is still DNA in the samples but I’d like to run a few more tests to completely confirm this.

In another discussion with the Roberts Lab I stated that we did use the modified Prok method on a spiked set of environmental samples and qPCR was successful with this experiment. I didn’t account for the fact that this experiment was run using plankton samples, pump samples not trap samples, however, and decided that we need to determine the usefulness of applying the ProK method to trap samples, which are more sediment rich than plankton samples. To do this we ran a series of experiments were three “bio reps” of a standard curve (1,5,10,15,20,25 spiked Oly larvae) were prepared using a previously collected trap sample.  We pipetted out approximately 1ml of trap sample and placed into labeled 50ml tubes. To these tubes we spiked cultured Oly larvae that were previously fixed with DMSO and transferred into 95% ethanol to make 3 replicate standard curves spiked into sediment. These “bio reps” were then transferred to 2ml eppendorf tubes and spun down to pipette out the ethanol supernatant and set out to dry. When the samples were dry, we added 1ml of the ProK solution and incubated the samples at 56C for 23 hours. For the last hour of cooking, we incubated at 95C  to denature ProK and then the samples were placed in the freezer until ready to use for qPCR. On 8/1/2016 and the results of this experiment are below.

08012016_mocksample1_averagedbioreps

screen-shot-2016-08-01-at-3-06-29-pm

Experiment: 08012016_MockTrapSamples_DNAExtractionTest  Selected Filter: FAM (465-510)
Include Color Pos Name # larvae Cp Concentration Standard Average StDev
TRUE 65280 A4 Sample 4 M1Oly1SC 1 0 28.472 1.185609548
TRUE 65280 A5 Sample 4 M1Oly1SC 1 0
TRUE 65280 A6 Sample 4 M1Oly1SC 1 0
TRUE 255 A7 Sample 7 M2Oly1SC 1 29.07 1.52E-01 0
TRUE 255 A8 Sample 7 M2Oly1SC 1 28.72 1.82E-01 0
TRUE 255 A9 Sample 7 M2Oly1SC 1 26.59 5.50E-01 0
TRUE 255 A10 Sample 10 M3Oly1SC 1 29.74 1.07E-01 0
TRUE 65280 A11 Sample 10 M3Oly1SC 1 0
TRUE 255 A12 Sample 10 M3Oly1SC 1 28.24 2.34E-01 0
TRUE 255 B4 Sample 16 M1Oly5SC 5 19.75 1.91E+01 0 23.99833333 4.366469588
TRUE 255 B5 Sample 16 M1Oly5SC 5 19.75 1.91E+01 0
TRUE 255 B6 Sample 16 M1Oly5SC 5 20.7 1.17E+01 0
TRUE 65280 B7 Sample 19 M2Oly5SC 5 0
TRUE 65280 B8 Sample 19 M2Oly5SC 5 0
TRUE 65280 B9 Sample 19 M2Oly5SC 5 0
TRUE 255 B10 Sample 22 M3Oly5SC 5 26.84 4.82E-01 0
TRUE 255 B11 Sample 22 M3Oly5SC 5 28.79 1.76E-01 0
TRUE 255 B12 Sample 22 M3Oly5SC 5 28.16 2.43E-01 0
TRUE 255 C4 Sample 28 M1Oly10SC 10 27.55 3.34E-01 0 27.05444444 1.376218652
TRUE 255 C5 Sample 28 M1Oly10SC 10 27.96 2.70E-01 0
TRUE 255 C6 Sample 28 M1Oly10SC 10 27.75 3.01E-01 0
TRUE 255 C7 Sample 31 M2Oly10SC 10 25.16 1.15E+00 0
TRUE 255 C8 Sample 31 M2Oly10SC 10 25.31 1.07E+00 0
TRUE 255 C9 Sample 31 M2Oly10SC 10 25.35 1.05E+00 0
TRUE 255 C10 Sample 34 M3Oly10SC 10 28.67 1.87E-01 0
TRUE 255 C11 Sample 34 M3Oly10SC 10 27.62 3.22E-01 0
TRUE 255 C12 Sample 34 M3Oly10SC 10 28.12 2.48E-01 0
TRUE 65280 D4 Sample 40 M1Oly15SC 15 0 25.36333333 0.663073651
TRUE 65280 D5 Sample 40 M1Oly15SC 15 0
TRUE 65280 D6 Sample 40 M1Oly15SC 15 0
TRUE 255 D7 Sample 43 M2Oly15SC 15 25.66 8.90E-01 0
TRUE 255 D8 Sample 43 M2Oly15SC 15 24.41 1.70E+00 0
TRUE 255 D9 Sample 43 M2Oly15SC 15 25.35 1.05E+00 0
TRUE 255 D10 Sample 46 M3Oly15SC 15 26.32 6.31E-01 0
TRUE 255 D11 Sample 46 M3Oly15SC 15 24.87 1.34E+00 0
TRUE 255 D12 Sample 46 M3Oly15SC 15 25.57 9.32E-01 0
TRUE 255 E4 Sample 52 M1Oly20SC 20 23.56 2.65E+00 0 24.10555556 4.23596834
TRUE 255 E5 Sample 52 M1Oly20SC 20 22.99 3.56E+00 0
TRUE 255 E6 Sample 52 M1Oly20SC 20 22.53 4.53E+00 0
TRUE 255 E7 Sample 55 M2Oly20SC 20 20.48 1.31E+01 0
TRUE 255 E8 Sample 55 M2Oly20SC 20 17.88 5.05E+01 0
TRUE 255 E9 Sample 55 M2Oly20SC 20 21.63 7.22E+00 0
TRUE 255 E10 Sample 58 M3Oly20SC 20 29.57 1.17E-01 0
TRUE 255 E11 Sample 58 M3Oly20SC 20 28.59 1.95E-01 0
TRUE 255 E12 Sample 58 M3Oly20SC 20 29.72 1.09E-01 0
TRUE 65280 F4 Sample 64 M1Oly25SC 25 0 23.42333333 0.372066302
TRUE 65280 F5 Sample 64 M1Oly25SC 25 0
TRUE 65280 F6 Sample 64 M1Oly25SC 25 0
TRUE 65280 F7 Sample 67 M2Oly25SC 25 0
TRUE 65280 F8 Sample 67 M2Oly25SC 25 0
TRUE 65280 F9 Sample 67 M2Oly25SC 25 0
TRUE 255 F10 Sample 70 M3Oly25SC 25 23.83 2.30E+00 0
TRUE 255 F11 Sample 70 M3Oly25SC 25 23.34 2.96E+00 0
TRUE 255 F12 Sample 70 M3Oly25SC 25 23.1 3.37E+00 0

Between the three BioReps (run in triplicate) there was a lot of variation using the ProK method of extraction and a number of questions arose.

 

 

michellenegron 9:33 AM on July 21, 2016  

Becker Lab-Fidalgo Bay 2013 sample analysis and complications update

Back story

The Becker Lab has been attempting qPCR for the quantification of Olympia larvae in trap samples that were collected in the Summer of 2013. These samples were passively collected in tube traps that were systematically placed throughout Fidalgo Bay and were originally fixed on site using DMSO in the trap and laster transferred into 50ml centrifuge tubes containing 95% ethanol. The samples have been stored in these same vials since collection for the past 3 years while we were troubleshooting our qPCR quantification methods. Since the DNR study has concluded with successful quantification of bivalve larvae in their pump samples, in March 2016 we have jumped into applying similar methods to finally work on the Fidalgo Bay samples.

Making Standard Curves

We decided to start with the trap samples and have collected hatchery reared Olympia larvae which we are using for our standard curves. These hatchery larvae were treated similar to the trap samples by first exposing the larvae to DMSO and then transferring the larvae into 95% ethanol. To create our standards, larvae were first counted in and placed in 2ml tubes. The standards were counted in sequence as follows: 1, 5, 10, 25, 50. For DNA extraction, we originally wanted to try theThe E.Z.N.A.® Mollusc DNA Kit but upon comparison of the two extraction methods, the ProK method worked just as effectively and had much less cost so we decided to continue with the ProK method. So, the standards underwent DNA extraction using the modified ProK methods that we used in Wight et al 2009 (Solution containing 10mMTris-HCl (pH 8.3), 50mMKCl, 0.5% Tween20, and 6 mAU (Anson units) proteinase K. Incubation time and temperatures18-24 hours incubation at 56C to activate ProK and extract DNA followed by 30min incubation at 95C to denature ProK). For extraction, each standard was dried overnight to evaporate remaining 95% ethanol, 1ml of ProK solution was added to each vial and then incubation occurred. After the denature process, the standards were frozen. Because during this time we were testing the Kit and the ProK method on the SAFS and UWT qPCR machines and running ethanol and DMSO fixed samples (that would represent the pump (ethanol) and trap samples (DMSO) only a single “biological” rep was made for the standards but these reps were run in triplicate as “technical” reps. The samples underwent qPCR using both machines but only the UWT machine results are shown below since we chose this machine to move forward with for analysis. QPCR was preformed using SsoAdvanced Universal Probes Supermix, the Wight et al. 2009 primers and probe: Fwd: TTTGAGTTTTGCCGGTTTCTC;  Rev: ATGCCCGGTCTACTGAACG; Probe: ACAGGTTGAACTGTTTACCCGCCGT  (5′ 6-FAM™ – 3′ Black Hole Quencher 1  100nmoles). and molecular water at a total reaction volume of 20ul. Combination of raw data, averages, and standard deviations for this standard curve run are below. We also plugged the equation in to our averages to see how an “unknown” would fit into our curve. For these “unknown” samples we used a 4th replicate of the 5, 25, and 50 standards. 

Include Color Pos Name Cp Concentration Standard Average Cp StDev Cp x=2.713^((y-28.171)/-1.575)
TRUE 128 A10 Sample 10 27.68 3.52E-01 ProK 1 28.09 0.601082357 1.052668685
TRUE 128 A11 Sample 10 27.81 3.23E-01 ProK 1
TRUE 128 A12 Sample 10 28.78 1.76E-01 ProK 1
TRUE 128 B10 Sample 22 25.81 1.14E+00 ProK 5 25.75333333 0.115902258 4.627611593
TRUE 128
B11
Sample 22 25.62 1.29E+00 ProK 5
TRUE 128 B12 Sample 22 25.83 1.13E+00 ProK 5
TRUE 128 C10 Sample 34 24.66 2.35E+00 ProK 10 24.62333333 0.040414519 9.469780813
TRUE 128 C11 Sample 34 24.58 2.47E+00 ProK 10
TRUE 128 C12 Sample 34 24.63 2.40E+00 ProK 10
TRUE 128 D10 Sample 46 22.87 7.27E+00 ProK 25 22.98666667 0.106926766 26.71534401
TRUE 128 D11 Sample 46 23.01 6.64E+00 ProK 25
TRUE 128 D12 Sample 46 23.08 6.39E+00 ProK 25
TRUE 128 E10 Sample 58 21.61 1.61E+01 ProK 50 21.52333333 0.232450712 67.52727175
TRUE 128 E11 Sample 58 21.7 1.52E+01 ProK 50
TRUE 128 E12 Sample 58 21.26 2.01E+01 ProK 50
TRUE 255 F10 Sample 70 24.82 2.13E+00 ProK UNKNOWN5 25.14 0.45254834 6.82574481
TRUE 255 F11 Sample 70 25.46 1.43E+00 ProK UNKNOWN5
TRUE 255 G10 Sample 82 22.83 7.44E+00 ProK UNKNOWN25 22.905 0.106066017 28.13428907
TRUE 255 G11 Sample 82 22.98 6.77E+00 ProK UNKNOWN25
TRUE 255 H10 Sample 94 21.52 1.70E+01 ProK UNKNOWN50 21.6 0.113137085 64.3250393

05122016MachinetestUWTReplicateof_AbsQuantFitPointsforallsamples

We decided that 50 larvae standard was too much for the machine to read and still be accurate so we decided to reduce the max of our curve to 25 and put two more points into it so our next standard curve would be 1, 5, 10, 15, 20 and 25.

We felt confident with our results and decisions, our ProK method was still working we had a plan of action for our curve, the ProK method worked fine with DMSO fixed larvae and decided to move forward with analyzing the first batch of Fidalgo Bay samples. To start analysis we selected a single site with in our sample base and run all of the time series for that summer collection period. Previous visual identification of larvae in the samples identified the S1A site area as a highly productive site with numerous larvae so we chose this site to start our analysis.

All samples for this site (there were 74 of them) were split in half using the Beaker technique which involves pouring the 50ml samples back and forth between two 50 ml tubes and then taken an even half of the sample which after the pouring is considered a homogenous sample. After the samples were split in half, half was kept for future analysis and the other half was pipetted into a 2ml tube to collect all plankton in the sample. The remaining ethanol in the samples was visually checked to ensure no larvae was left behind. These samples were then removed of any remaining ethanol and dried overnight. The following day the samples underwent DNA extraction using the modified ProK method. I also redid the standard curve at this time using the new curve points (1, 5, 10, 15, 20 and 25). We did 56 the first day and the remaining samples the next since we were limited to how many we could do at once using the heat block. There was also an issue with the ProK solution that we were using. At first we had enough of the ThermoScientific Brand ProK but then had to make more and upon that realization, I noticed that the ProK that I had ordered was a VWR brand. Thinking that there should be no difference,  continued on using this ProK for the digestions.

When the digestion was complete, the samples were run on qPCR using the UWT machine and the new standards. These results are below. I think the image shows enough…

S1A_06062016_AbsQuantFitPoints_AllSampleSubset_ScreenShot

The above image shows the first of three plates that were run to complete the SIA sample subset for Fidalgo Bay 2013. Only the standards show amplification . All the green dots (with exception to 10, 11 and 12 on row H) contained sample in it. Because all three plates showed similar results (with only the standard curve showing and very little Oly DNA amplification at a reliable Ct we were concerned that the samples may have degraded, that there were no Oly larvae in the samples or that the extraction method didn’t work.

To see if there were any Oly larvae in the samples at all, 8 samples that underwent visual confirmation in 2013 of any bivalve larvae present in them were selected and visually identified to clam  and Oly larvae present. Below is a table of the eight samples inspected and the results of identification. The “Tube #” column denote the vial tube that we use to id the sample, the “Sample ID” column is the actual sample name and date. We also checked the pH.

Tube # Sample ID Oly Larvae present pH Notes
28 S1A_S_7/11-18/13_2 yes, lots of bivalves some oly 4 1 270um oly
39 S1A_B_7/11-18/13_2 0 4 1 400um clam, 1 clam, clam
50 S1A_S_7/11-18/13_3 yes, lots of bivalves some oly 4 oly1, 2  250ul oly, a few more oly and a few clams
61 S1A_B_7/11-18/13_3 yes 4 300um oly, 1 clam 2 clams 1 2230um oly, 1 275um oly, 1 clam
68 S1A_S_5/10-16/13_2 0 4 clam330um*, clam 400 350um clam*
69 S1A_B_5/2-10/13_2 0 4 1 clam 300um
72 S1A_S_5/10-16/13_3 0 4 1 clam 350um*
73 S1A_B_5/2-10/13_3 0 4 na

Upon visual identification of 8 samples that were checked visually for any bivalve larvae, I was able to identify that there were Oly larvae in some of the samples, so there should be Oly DNA in the extractions if it worked and if the DNA hasn’t degraded over the years in storage.

To test degradation of DNA in the samples we preformed PCR on all the samples using the same oly primers used in qPCR. No images here are listed because no PCR product showed after PCR was done on all 74 samples. PCR also didn’t work on the standard curves however, which was confusing since the standards worked with qPCR.

Because PCR using the Oly primers didn’t work, we wanted to see if there was ANY DNA detectable in the samples. We used the nano drop at UWT to determine concentration and purity of DNA in the samples and below is the table of those results.

Full sample name Sample # abreviation Absorbance (A260 10mm) Purity Ratio (A260/A280) Concentration (ng/ul)
S1A_S_5/10-16/13_1 1 1.529 0.97 76.5
S1A_S_5/16-23/13_1 2 1.983 1.1 99.2
S1A_S_5/23-30/13_1 3 3.141 1.1 157.1
S1A_S_5/30-6/6/13_1 4 1.909 1.04 95.4
S1A_S_6/6-13/13_1 5 2.539 1.07 127
S1A_S_6/13-20/13_1 6 2.38 1.15 119
S1A_S_6/20-27/13_1 7 3.818 1.12 190.9
S1A_S_6/27-7/3/13_1 8 1.427 0.98 71.4
S1A_S_7/3-11/13_1 9 3.892 1.1 194.6
S1A_S_7/18-25/13_1 10 4.361 1.14 218.1
S1A_B_5/16-23/13_1 11 1.618 1.02 80.9
S1A_B_5/23-30/13_1 12 2.949 1.22 147.5
S1A_B_5/30-6/6/13_1 13 1.443 0.99 72.1
S1A_B_6/6-13/13_1 14 1.563 0.97 78.2
S1A_B_6/13-20/13_1 15 1.503 1.06 75.1
S1A_B_6/20-27/13_1 16 3.131 1.1 156.6
S1A_B_6/27-7/3/13_1 17 2.243 1.02 112.1
S1A_B_7/3-11/13_1 18 2.597 1.13 129.8
S1A_B_7/18-25/13_1 19 2.477 1.13 123.9
S1A_S_5/16-23/13_2 20 2.063 1.11 103.2
S1A_S_5/23-30/13_2 21 3.148 1.09 157.4
S1A_S_5/30-6/6/13_2 22 1.743 1.03 87.2
S1A_S_6/6-13/13_2 23 2.51 1.03 125.5
S1A_S_6/13-20/13_2 24 1.409 1.02 70.4
S1A_S_6/20-27/13_2 25 2.455 1.04 122.8
S1A_S_6/27-7/3/13_2 26 2.849 1.06 142.5
S1A_S_7/3-11/13_2 27 4.438 1.1 221.9
S1A_S_7/11-18/13_2 28 2.733 1.1 136.6
S1A_S_7/18-25/13_2 29 0.723 0.85 36.2
S1A_S_7/25-8/1/13_2 30 3.134 1.14 156.7
S1A_B_5/16-23/13_2 31 1.393 1.06 69.7
S1A_B_5/23-30/13_2 32 2.95 1.26 147.5
S1A_B_5/30-6/6/13_2 33 1.106 0.94 55.3
S1A_B_6/6-13/13_2 34 1.447 1.03 72.3
S1A_B_6/13-20/13_2 35 1.185 0.96 59.3
S1A_B_6/20-27/13_2 36 2.317 1.1 115.9
S1A_B_6/27-7/3/13_2 37 1.173 0.99 58.7
S1A_B_7/3-11/13_2 38 2.729 1.06 136.4
S1A_B_7/11-18/13_2 39 2.914 1.11 145.7
S1A_B_7/18-25/13_2 40 0.764 0.86 38.2
S1A_B_7/25-8/1/13_2 41 2.259 1.17 113
S1A_S_5/16-23/13_3 42 1.64 1.03 82
S1A_S_5/23-30/13_3 43 4.001 1.11 200
S1A_S_5/30-6/6/13_3 44 1.874 0.96 93.7
S1A_S_6/6-13/13_3 45 3 1.04 150
S1A_S_6/13-20/13_3 46 2.273 1.11 113.6
S1A_S_6/20-27/13_3 47 3.984 1.07 199.2
S1A_S_6/27-7/3/13_3 48 2.395 1.07 119.8
S1A_S_7/3-11/13_3 49 2.782 1.06 139.1
S1A_S_7/11-18/13_3 50 2.337 1.06 116.8
S1A_S_7/18-25/13_3 51 4.031 1.13 201.5
S1A_S_7/25-8/1/13_3 52 1.662 1.01 83.1
S1A_B_5/16-23/13_3 53 1.47 1.09 73.5
S1A_B_5/23-30/13_3 54 2.118 1.17 105.9
S1A_B_5/30-6/6/13_3 55 1.068 0.94 53.4
S1A_B_6/6-13/13_3 56 1.696 0.99 84.8
S1A_B_6/13-20/13_3 57 1.101 0.96 55.1
S1A_B_6/20-27/13_3 58 1.824 1.05 91.2
S1A_B_6/27-7/3/13_3 59 1.204 1.03 60.2
S1A_B_7/3-11/13_3 60 2.041 1.11 102.1
S1A_B_7/11-18/13_3 61 2.063 1.12 103.2
S1A_B_7/18-25/13_3 62 2.83 1.13 141.5
S1A_B_7/25-8/1/13_3 63 1.103 0.98 55.1
S1A_S_5/2-10/13_1 64 1.554 1.03 77.7
S1A_B_5/2-10/13_1 65 1.383 1.08 69.2
S1A_B_5/10-16/13_1 66 0.942 0.92 47.1
S1A_S_5/2-10/13_2 67 1.345 1.01 67.3
S1A_S_5/10-16/13_2 68 1.122 1.07 56.1
S1A_B_5/2-10/13_2 69 1.023 0.96 51.1
S1A_B_5/10-16/13_2 70 0.775 0.9 38.8
S1A_S_5/2-10/13_3 71 1.633 1.05 81.7
S1A_S_5/10-16/13_3 72 1.243 1.04 62.1
S1A_B_5/2-10/13_3 73 1.219 1.01 60.9
S1A_B_5/10-16/13_3 74 1.113 1.02 55.6

After using the nano drop we were concerned that the purity ratios weren’t good enough since after consulting with other professors we would want a purity of around 1.50 (A260/A280) and we just overall didn’t know if these numbers were good or not. We asked Steven and Sam and Sam suggested that we use a Qubit Fluorometer to test the concentrations of the samples instead. Below are those results. For the Qubit, we read the samples using the Broad Range samples and reagents and used a 20ul sample and 180ul of the reagents and the Qubit tubes. We added the 180 reagent mixture of dye and buffer (1:199) and added the 20ul sample after the BR solution was added. We vortexed the samples then centrifuged down to eliminate bubbles and allowed to sit for 2 min before taking the reading.

Full sample name Sample # abbreviation Qubit 06272016_[DNA] (ng/microliter)_sample
S1A_S_5/10-16/13_1 1 0.212
S1A_S_5/16-23/13_1 2 0.369
S1A_S_5/23-30/13_1 3 1.23
S1A_S_5/30-6/6/13_1 4 0.526
S1A_S_6/6-13/13_1 5 0.86
S1A_S_6/13-20/13_1 6 0.708
S1A_S_6/20-27/13_1 7 1.67
S1A_S_6/27-7/3/13_1 8 0.15
S1A_S_7/3-11/13_1 9 1.35
S1A_S_7/18-25/13_1 10 1.94
S1A_B_5/16-23/13_1 11 0.271
S1A_B_5/23-30/13_1 12 0.971
S1A_B_5/30-6/6/13_1 13 0.257
S1A_B_6/6-13/13_1 14 0.281
S1A_B_6/13-20/13_1 15 0.259
S1A_B_6/20-27/13_1 16 1.17
S1A_B_6/27-7/3/13_1 17 0.684
S1A_B_7/3-11/13_1 18 0.691
S1A_B_7/18-25/13_1 19 0.757
S1A_S_5/16-23/13_2 20 0.527
S1A_S_5/23-30/13_2 21 1.2
S1A_S_5/30-6/6/13_2 22 0.418
S1A_S_6/6-13/13_2 23 0.933
S1A_S_6/13-20/13_2 24 0.256
S1A_S_6/20-27/13_2 25 0.936
S1A_S_6/27-7/3/13_2 26 0.922
S1A_S_7/3-11/13_2 27 1.75
S1A_S_7/11-18/13_2 28 1.04
S1A_S_7/18-25/13_2 29 LOW
S1A_S_7/25-8/1/13_2 30 0.969
S1A_B_5/16-23/13_2 31 0.226
S1A_B_5/23-30/13_2 32 0.82
S1A_B_5/30-6/6/13_2 33 0.178
S1A_B_6/6-13/13_2 34 0.257
S1A_B_6/13-20/13_2 35 0.109
S1A_B_6/20-27/13_2 36 0.644
S1A_B_6/27-7/3/13_2 37 0.114
S1A_B_7/3-11/13_2 38 0.595
S1A_B_7/11-18/13_2 39 0.835
S1A_B_7/18-25/13_2 40 LOW
S1A_B_7/25-8/1/13_2 41 0.477
S1A_S_5/16-23/13_3 42 0.282
S1A_S_5/23-30/13_3 43 1.58
S1A_S_5/30-6/6/13_3 44 0.5
S1A_S_6/6-13/13_3 45 1.27
S1A_S_6/13-20/13_3 46 0.602
S1A_S_6/20-27/13_3 47 1.48
S1A_S_6/27-7/3/13_3 48 0.785
S1A_S_7/3-11/13_3 49 0.921
S1A_S_7/11-18/13_3 50 0.783
S1A_S_7/18-25/13_3 51 1.83
S1A_S_7/25-8/1/13_3 52 0.594
S1A_B_5/16-23/13_3 53 0.251
S1A_B_5/23-30/13_3 54 0.484
S1A_B_5/30-6/6/13_3 55 LOW
S1A_B_6/6-13/13_3 56 0.303
S1A_B_6/13-20/13_3 57 0.113
S1A_B_6/20-27/13_3 58 0.533
S1A_B_6/27-7/3/13_3 59 LOW
S1A_B_7/3-11/13_3 60 0.401
S1A_B_7/11-18/13_3 61 0.412
S1A_B_7/18-25/13_3 62 0.886
S1A_B_7/25-8/1/13_3 63 LOW
S1A_S_5/2-10/13_1 64 0.467
S1A_B_5/2-10/13_1 65 0.29
S1A_B_5/10-16/13_1 66 0.126
S1A_S_5/2-10/13_2 67 0.361
S1A_S_5/10-16/13_2 68 0.174
S1A_B_5/2-10/13_2 69 0.134
S1A_B_5/10-16/13_2 70 LOW
S1A_S_5/2-10/13_3 71 0.335
S1A_S_5/10-16/13_3 72 0.219
S1A_B_5/2-10/13_3 73 0.248
S1A_B_5/10-16/13_3 74 0.13
1olysc SC LOW
5olysc SC LOW
10olysc SC LOW
15olysc SC LOW
20olysc  SC LOW
25olysc  SC LOW

Now we were more confused because the readings were super low and some (including the standard curves which we knew to have DNA in them from qPCR data) showed too low of a concentration to read. On top of that confusion, we also noticed that the nano drop results were quite different than the Qubit ones, so which do we believe. And what is the min DNA concentration that we can use when quantifying larvae using qPCR? We put these questions on hold for a moment and wondered is somehow the change in ProK brand may have interfered with DNA extraction and then qPCR.

Testing the Two Brands of ProK used to extract DNA from samples

To test the different brands, I first contacted the manufacturer VWR to see if they had more information on the product since there is no literature that comes with it or on line about what is in it and to ask them why the VWR brand can be stored in the fridge where as the ThermoScientific (TS) brand needs to be frozen. They said that they are basically the same and the only main difference between them is that the TS brand is from a recombinant protein and the VWR brand is made for molecular biology studies and is a native protein. I decided to make two different curves using each brand ProK solution and test them to see if there is a difference. I digested them the same using methods as I did with the Fidalgo 2013 samples from the Wight et al 2009 paper and made the standards using 1, 5, 10, 15, 20 and 25 larvae. After this was done I used them for PCR with no results for PCR (At this point I thought we had PCR method issues cause we should be getting some kind of amplified product using Oly primers). At this time I also ordered the Eukaryotic primer sets that Sam offered I use if we wanted to test the samples for ANY DNA present.

Knowing that the standards worked previously with qPCR I decided to test the ProK extractions using qPCR and see if there was a noticeable difference. below are the results from that in table and graph form.

Raw Data

Experiment: 07052016_TS and VWD standard curves Selected Filter: FAM (465-510) Using Abs Quant Fit Points Analysis
Include Color Pos Brand ProK Name Cp Concentration Standard Status
TRUE 128 A1 TS Sample 1 25.11 1.07E+00 1
TRUE 128 A2 TS Sample 1 25.15 1.04E+00 1
TRUE 128 A3 TS Sample 1 25.46 8.11E-01 1
TRUE 128 A4 TS Sample 4 23.96 2.68E+00 5
TRUE 128 A5 TS Sample 4 23.37 4.24E+00 5
TRUE 128 A6 TS Sample 4 23.73 3.19E+00 5
TRUE 128 A7 VWR Sample 7 25.34 8.94E-01 1
TRUE 128 A8 VWR Sample 7 25.17 1.02E+00 1
TRUE 128 A9 VWR Sample 7 25.08 1.10E+00 1
TRUE 128 A10 VWR Sample 10 23.18 4.94E+00 5
TRUE 128 A11 VWR Sample 10 23.07 5.38E+00 5
TRUE 128 A12 VWR Sample 10 22.97 5.85E+00 5
TRUE 128 B1 TS Sample 13 22.24 1.04E+01 10
TRUE 128 B2 TS Sample 13 22.12 1.14E+01 10
TRUE 128 B3 TS Sample 13 22.03 1.23E+01 10
TRUE 128 B4 TS Sample 16 22.01 1.25E+01 15
TRUE 128 B5 TS Sample 16 22.16 1.11E+01 15
TRUE 128 B6 TS Sample 16 22.41 9.06E+00 15
TRUE 128 B7 VWR Sample 19 22.17 1.09E+01 10
TRUE 128 B8 VWR Sample 19 22.25 1.03E+01 10
TRUE 128 B9 VWR Sample 19 22.2 1.07E+01 10
TRUE 128 B10 VWR Sample 22 21.34 2.11E+01 15
TRUE 128 B11 VWR Sample 22 21.43 1.98E+01 15
TRUE 128 B12 VWR Sample 22 21.06 2.65E+01 15
TRUE 128 C1 TS Sample 25 22.14 1.12E+01 20
TRUE 128 C2 TS Sample 25 22.16 1.11E+01 20
TRUE 128 C3 TS Sample 25 22.27 1.02E+01 20
TRUE 128 C4 TS Sample 28 21.32 2.15E+01 25
TRUE 128 C5 TS Sample 28 20.89 3.01E+01 25
TRUE 128 C6 TS Sample 28 20.85 3.13E+01 25
TRUE 128 C7 VWR Sample 31 21.28 2.22E+01 20
TRUE 128 C8 VWR Sample 31 21.34 2.12E+01 20
TRUE 128 C9 VWR Sample 31 21.33 2.13E+01 20
TRUE 128 C10 VWR Sample 34 21.23 2.31E+01 25
TRUE 128 C11 VWR Sample 34 20.38 4.52E+01 25
TRUE 65280 C12 Sample 36 0
TRUE 65280 D1 NTC Sample 37 0
TRUE 65280 D2 NTC Sample 37 0
TRUE 65280 D3 NTC Sample 37 0
TRUE 255 D4 TC Sample 40 13.92 7.52E+03 0 E – Extrapolated concentration in standard curve
0

Averages from data

ThermoScientific ProK Solution
Standard Average StDev
1 25.24 0.191572441
5 23.68666667 0.297377426
10 22.13 0.105356538
15 22.19333333 0.202072594
20 22.19 0.07
25 21.02 0.260576284
VWR ProK Solution
Standard Average StDev
1 25.19666667 0.132035349
5 23.07333333 0.105039675
10 22.20666667 0.040414519
15 21.27666667 0.192959409
20 21.31666667 0.032145503
25 20.805 0.601040764

Graphs of curves

07052016_TSCurve07052016_VWRCurve.jpg07052016_ComparisonofProKbrandcurves.jpg

Upon comparison, there didn’t seem to be much of a difference between the two ProK brands, if anything the VWR brand seems more sensitive, but that could just be that “biological” rep. I also used the Qubit to determine concentration of DNA in these samples to see if there was a major difference there, and there was not. Below are the results.

Brand ProK Standard Qubit 06302016_[DNA] (ng/ul)_sample Qubit 06302016_[Tube]sample ug/mL Notes
Thermo Scientific 1 Low Low
Thermo Scientific 1 Low Low
Thermo Scientific 1 Low Low
Thermo Scientific 5 Low Low
Thermo Scientific 5 Low Low
Thermo Scientific 5 Low Low
Thermo Scientific 10 5.20E-03 5.20E-04
Thermo Scientific 10 5.10E-03 5.10E-04
Thermo Scientific 10 5.00E-03 5.00E-04
Thermo Scientific 10 Low Low read 4th time accident
Thermo Scientific 15 Low Low
Thermo Scientific 15 Low Low
Thermo Scientific 15 Low Low
Thermo Scientific 20 5.20E-03 5.20E-04
Thermo Scientific 20 5.10E-03 5.10E-04
Thermo Scientific 20 5.10E-03 5.10E-04
Thermo Scientific 25 6.70E-03 6.70E-04
Thermo Scientific 25 6.30E-03 6.30E-04
Thermo Scientific 25 6.30E-03 6.30E-04
VWR 1 Low Low
VWR 1 Low Low
VWR 1 Low Low
VWR 5 Low Low
VWR 5 Low Low
VWR 5 Low Low
VWR 10 Low Low
VWR 10 Low Low
VWR 10 Low Low
VWR 15 Low Low
VWR 15 6.90E-03 6.90E-04
VWR 15 6.60E-03 6.60E-04
VWR 20 5.60E-03 5.60E-04
VWR 20 5.50E-03 5.50E-04
VWR 20 5.20E-03 5.20E-04
VWR 25 9.30E-03 9.30E-04
VWR 25 9.10E-03 9.10E-04
VWR 25 9.30E-03 9.30E-04

Many of the samples from each of the different standard curves showed too low of concentration of DNA to detect using the Broad Range spectrum.

I feel like the ProK brand isn’t the issue we are having, it must be more to do with wether or not we have DNA in the samples and if there is enough of it to reliable detect and use with qPCR. Decided to try precipitating the DNA in these standards and see if we can concentrate the DNA and get detectable concentrations of DNA after precipitation.

Precipitating DNA of two ProK Brand Standards

To precipitate DNA in the standards, I followed similar methods that we use to isolate DNA with the DNAzol method when applied to adult bivalves. I added 1ml 100% ethanol to each tube inverted 8 times and allowed to sit upright for three minutes. When done centrifuged for 5 minutes at 5000G to sediment DNA into a pellet at the bottom of the tube.When finished I didn’t see the pellet so to be sure that it was all sedimented at the bottom re-centrifuged for another 5 min at 5000G.When centrifugation was completed, pipetted out supernatant as much as possible with out disturbing the bottom of the tube where the pellet would have formed, but at this time it’s still not visible. Discarded supernatant. For Step 4 (DNAzol protocol), DNA wash, of the DNAzol protocol, I figured we didn’t necessarily need to do the part where there was a 70:30 DNAzol:Ethanol mix which we did before (I would have done with ProK if I chose this route). Instead used just 75% ethanol for DNA wash and only used 500ul for it. Pipetted 500ul of 75% ethanol into each standard and suspended pellet by inversion and finger vortexing. Allowed to sit for 3 minutes then centrifuged for 5min at 5000G. After centrifuging the supernatant was discarded. Repeated this step once.When finished, tried to pipette out as much ethanol as possible, also tried to allow to air dry for approx 30 minutes.To resuspend pellet, 150ul of molecular grade water was added to each standard and resuspended by finger vortexing and spun down to isolate liquid. Took samples to read DNA concentration using the Qubit. Below are the results comparing the original Qubit readings before precipitation and the Qubit results after precipitating the DNA in the standards.

Comparing DNA concentration before (06302016) and after (07072016) precipitating DNA in the standards (below).
Brand ProK Standard Qubit 07072016_[DNA] (ng/microliter)_sample Qubit 06302016_[DNA] (ng/microliter)_sample
Thermo Scientific 1 6.50E-03 Low
Thermo Scientific 1 6.40E-03 Low
Thermo Scientific 1 6.40E-03 Low
Thermo Scientific 5 6.80E-03 Low
Thermo Scientific 5 6.60E-03 Low
Thermo Scientific 5 6.70E-03 Low
Thermo Scientific 10 7.40E-03 5.20E-03
Thermo Scientific 10 7.30E-03 5.10E-03
Thermo Scientific 10 7.20E-03 5.00E-03
Thermo Scientific 15 7.10E-03 Low
Thermo Scientific 15 7.00E-03 Low
Thermo Scientific 15 6.90E-03 Low
Thermo Scientific 20 9.60E-03 5.20E-03
Thermo Scientific 20 9.50E-03 5.10E-03
Thermo Scientific 20 9.40E-03 5.10E-03
Thermo Scientific 25 8.80E-03 6.70E-03
Thermo Scientific 25 8.60E-03 6.30E-03
Thermo Scientific 25 8.60E-03 6.30E-03
VWR 1 7.30E-03 Low
VWR 1 7.20E-03 Low
VWR 1 7.20E-03 Low
VWR 5 6.50E-03 Low
VWR 5 6.50E-03 Low
VWR 5 6.40E-03 Low
VWR 10 7.10E-03 Low
VWR 10 6.90E-03 Low
VWR 10 6.90E-03 Low
VWR 15 7.30E-03 Low
VWR 15 6.30E-03 6.90E-03
VWR 15 7.20E-03 6.60E-03
VWR 20 8.10E-03 5.60E-03
VWR 20 8.00E-03 5.50E-03
VWR 20 7.60E-03 5.20E-03
VWR 25 1.00E-02 9.30E-03
VWR 25 9.70E-03 9.10E-03
VWR 25 9.50E-03 9.30E-03

Precipitating the standards appeared to have worked so now we wanted to use them with qPCR and PCR.

qPCR on precipitated standards

Using the precipitated DNA standards we prepared qPCR reactions in reps of 4 for each ProK brand so that we could measure DNA concentration before qPCR, after qPCR , have qPCR data and finally run the resulting end reactions on PCR to see if we get an amplified PCR product (first step in testing our PCR methods).

Aliquoting primers and probe
  • .5ml of molecular grade water was poured into a labeled eppendorf tube.
  • Oly primers and probe were aliquoted at 100ul of 10mM aliquots by first adding 90ul of molecular grade water and 10ul of each respective primer or probe at starting concentration of 100mM.
  • After making each aliquot, they were finger vortexed and centrifuged down to isolate liquid.

Preparing Master mix

  • Master mix was made with the following ingredients and volumes.
 vol pr rxn Total rxns vol*#rxns 10% Error total vol needed
Mix 10 55 550 55 605
FWD 0.8 55 44 4.4 48.4
REV 0.8 55 44 4.4 48.4
Probe 0.4 55 22 2.2 24.2
Water 6 55 330 33 363
Template 2
  • To make the master mix, SsoAdvanced super mix was added first followed by the Fwd and Rev primers, Probe, and lastly with molecular grade water.
  • After combining ingredients, the mix was inverted multiple times then centrifuged down to isolate solution.
Plate set up
  • Used the following layout for the plate set up.
  • Note that columns 1-4 were used for the ThermoScientific brand of ProK standards sand columns 5-8 were used for the standards digested in VWR brand ProK.
 TS Standards Columns 1-4 VWR Standards Columns 5-6
1 2 3 4 5 6 7 8 9 10 11 12
A 1OlySC 1OlySC 1OlySC 1OlySC 1OlySC 1OlySC 1OlySC 1OlySC
B 5OlySC 5OlySC 5OlySC 5OlySC 5OlySC 5OlySC 5OlySC 5OlySC
C 10OlySC 10OlySC 10OlySC 10OlySC 10OlySC 10OlySC 10OlySC 10OlySC
D 15OlySC 15OlySC 15OlySC 15OlySC 15OlySC 15OlySC 15OlySC 15OlySC
E 20OlySC 20OlySC 20OlySC 20OlySC 20OlySC 20OlySC 20OlySC 20OlySC
F 25OlySC 25OlySC 25OlySC 25OlySC 25OlySC 25OlySC 25OlySC 25OlySC
G NTC NTC NTC
H
  • Reactions were pipetted in groups based on proK brand (made all TS standard reactions first, then all VWR reactions).
  • Uncapped columns 1-4.
  • Pipetted 18ul of master mix into each well being used. Had to do slowly and carefully in a pouring type action so could avoid as many bubbles as possible.
  • Pipetted 2ul of the template and added to each respective well. This was added directly above the master mix liquid so formed a drop off the pipette tib then slowly touched to the master mix liquid so contact was made and exchange of liquid from tip to master mix reaction was made. This was done to avoid as many bubbles as possible.
  •  After the template was added, used the template tip to mix reaction by slowly pipetting up and down carefully to avoid bubbles.
  • Lids were capped and then uncapped VWR lids.
  • VWS standard reactions were made same as TS standards.
  • NTC was made using molecular water as the template.
 
Running Qubit (before qPCR)
Before taking the plate to 336 where the qPCR machine is I prepared the Qubit reactions.
I wanted to make enough of the reagent for both before and after qPCR Qubit reactions so made a total enough to read 30 samples ( Only needed 26 since also reading a NTC but this gives a little room for error).
Used the High Sensitive reagents since so far we are only able to detect DNA using the HIGH SENSITIVITY setting.
Used the following ingredients to make Qubit reagents.
Component for Reagent Standard Volume (uL) per sample number of samples Volumn (uL) fo ALL
Dye 1 30 30
Buffer 199 30 5970
  • Made reagent by first adding the Buffer and then the Dye to a 15ml centrifuge tube.
  • Inverted tube to mix solution well.
  • Labeled 26 Qubit specific tubes with respective standard and added a P to denote that these were readings for after Precipitating the DNA from the original extraction and added either a qPCR before or after to the tube to denote if it was a reaction from before or after qpcr so it will let me know which is which at a later day.
  • These labels were only labeled on top not the side which would cause a mis reading of fluorescence.
  • Added 180ul of reagent to each tube.
  • Took the 4th replicate (columns 4 and 8) and added 20ul of reaction in those wells (which was all of the reaction) and added to each labeled Qubit tube matching labeled tube with reaction in well using the plate diagram above as a guide.
  • Vortexed for 5 seconds and centrifuged down until no bubbles remained in the reactions.
  • Allowed to stand upright for 2 minutes before reading the initial DNA concentration (fluorescence) of the reactions.
  • After the two minutes was done, I turned the Qubit and selected dsDNA High sensitivity 20ul sample volume.
  • Placed the first tube in the tube slot closed the lid and hit read sample. Started with P1OlySCTSbefore and moved through all of the TS standards then started with the VWR standards 1-25.
  • Read the standard three times before moving onto the next standard.
  • A value of LOW indicates that the concentration of DNA in the sample was too low to detect.
Brand ProK Standard Qubit before qPCR 07112016_[DNA] (ng/ml)_sample ng/ul
Thermo Scientific 1 862 0.862
Thermo Scientific 1 861 0.861
Thermo Scientific 1 860 0.86
Thermo Scientific 5 822 0.822
Thermo Scientific 5 822 0.822
Thermo Scientific 5 821 0.821
Thermo Scientific 10 803 0.803
Thermo Scientific 10 802 0.802
Thermo Scientific 10 801 0.801
Thermo Scientific 15 861 0.861
Thermo Scientific 15 860 0.86
Thermo Scientific 15 859 0.859
Thermo Scientific 20 LOW #VALUE!
Thermo Scientific 20 LOW #VALUE!
Thermo Scientific 20 LOW #VALUE!
Thermo Scientific 25 836 0.836
Thermo Scientific 25 836 0.836
Thermo Scientific 25 834 0.834
VWR 1 874 0.874
VWR 1 865 0.865
VWR 1 861 0.861
VWR 5 849 0.849
VWR 5 848 0.848
VWR 5 846 0.846
VWR 10 877 0.877
VWR 10 875 0.875
VWR 10 874 0.874
VWR 15 841 0.841
VWR 15 840 0.84
VWR 15 838 0.838
VWR 20 863 0.863
VWR 20 861 0.861
VWR 20 858 0.858
VWR 25 886 0.886
VWR 25 882 0.882
VWR 25 879 0.879
NTC NTC 849 0.849
NTC NTC 845 0.845
NTC NTC 843 0.843

Running qPCR

  • Made sure all of the lids were capped and wiped them with a kim wipe.
  • Placed the plate in the machine and ht new experiment from existing template.
  • Selected Fidalgo 2013Template as the program to run which uses the parameters listed below for the cycles.

1) Incubate 95C 2min 30sec

2) 95C 30sec

3) 60C for 50sec

4) Plate read

5) Repeat steps 2-4 39 more times

6) Program end

  • Hit run
  • After run was performed, noticed that some of the lids popped off during qPCR which may have caused evaporation in some of the samples.
  • The samples where this occurred are Column 7 row a, b, and c. These are the reactions that will be used for running the Qubit so they may have a higher concentration in it than normal or not enough sample to really be the 20ul that I am trying to run with.

qPCR Raw data

Experiment: 07112016_TSProK_VWRProK_TEST Selected Filter: FAM (465-510)
Include Color Pos Name Cp Concentration Standard Standard
TRUE 128 A1 Sample 1 30.51 TS1 1
TRUE 128 A2 Sample 1 30.3 TS1 1
TRUE 128 A3 Sample 1 29 TS1 1
TRUE 128 A4 Sample 1 QB1_TS1 1
TRUE 128 A5 Sample 5 30.62 VWR1 1
TRUE 128 A6 Sample 5 30.83 VWR1 1
TRUE 128 A7 Sample 5 30.58 VWR1 1
TRUE 128 A8 Sample 5 QB1_VWR1 1
TRUE 65280 A9 Sample 9 BLANK 0
TRUE 65280 A10 Sample 9 BLANK 0
TRUE 65280 A11 Sample 9 BLANK 0
TRUE 65280 A12 Sample 9 BLANK 0
TRUE 128 B1 Sample 13 27.53 TS5 5
TRUE 128 B2 Sample 13 27.29 TS5 5
TRUE 128 B3 Sample 13 27.45 TS5 5
TRUE 128 B4 Sample 13 QB1_TS5 5
TRUE 128 B5 Sample 17 27.8 VWR5 5
TRUE 128 B6 Sample 17 27.88 VWR5 5
TRUE 128 B7 Sample 17 27.79 VWR5 5
TRUE 128 B8 Sample 17 QB1_VWR5 5
TRUE 65280 B9 Sample 21 BLANK 0
TRUE 65280 B10 Sample 22 BLANK 0
TRUE 65280 B11 Sample 23 BLANK 0
TRUE 65280 B12 Sample 24 BLANK 0
TRUE 128 C1 Sample 25 25.64 TS10 10
TRUE 128 C2 Sample 25 25.41 TS10 10
TRUE 128 C3 Sample 25 TS10 10
TRUE 128 C4 Sample 25 QB1_TS10 10
TRUE 128 C5 Sample 29 26.55 VWR10 10
TRUE 128 C6 Sample 29 26.5 VWR10 10
TRUE 128 C7 Sample 29 26.46 VWR10 10
TRUE 128 C8 Sample 29 29.96 QB1_VWR10 10
TRUE 65280 C9 Sample 33 BLANK 0
TRUE 65280 C10 Sample 34 BLANK 0
TRUE 65280 C11 Sample 35 BLANK 0
TRUE 65280 C12 Sample 36 BLANK 0
TRUE 128 D1 Sample 37 25.65 TS15 15
TRUE 128 D2 Sample 37 25.72 TS15 15
TRUE 128 D3 Sample 37 25.87 TS15 15
TRUE 128 D4 Sample 37 QB1_TS15 15
TRUE 128 D5 Sample 41 25.87 VWR15 15
TRUE 128 D6 Sample 41 25.61 VWR15 15
TRUE 128 D7 Sample 41 25.93 VWR15 15
TRUE 128 D8 Sample 41 30.78 QB1_VWR15 15
TRUE 65280 D9 Sample 45 BLANK 0
TRUE 65280 D10 Sample 46 BLANK 0
TRUE 65280 D11 Sample 47 BLANK 0
TRUE 65280 D12 Sample 48 BLANK 0
TRUE 128 E1 Sample 49 23.97 TS20 20
TRUE 128 E2 Sample 49 24.16 TS20 20
TRUE 128 E3 Sample 49 24.01 TS20 20
TRUE 128 E4 Sample 49 23.92 QB1_TS20 20
TRUE 128 E5 Sample 53 24.68 VWR20 20
TRUE 128 E6 Sample 53 24.18 VWR20 20
TRUE 128 E7 Sample 53 24.66 VWR20 20
TRUE 128 E8 Sample 53 30.98 QB1_VWR20 20
TRUE 65280 E9 Sample 57 BLANK 0
TRUE 65280 E10 Sample 58 BLANK 0
TRUE 65280 E11 Sample 59 BLANK 0
TRUE 65280 E12 Sample 60 BLANK 0
TRUE 128 F1 Sample 61 23.76 TS25 25
TRUE 128 F2 Sample 61 23.59 TS25 25
TRUE 128 F3 Sample 61 24.16 TS25 25
TRUE 128 F4 Sample 61 QB1_TS25 25
TRUE 128 F5 Sample 65 23.4 VWR25 25
TRUE 128 F6 Sample 65 22.98 VWR25 25
TRUE 128 F7 Sample 65 22.77 VWR25 25
TRUE 128 F8 Sample 65 26.3 QB1_VWR25 25
TRUE 65280 F9 Sample 69 BLANK 0
TRUE 65280 F10 Sample 70 BLANK 0
TRUE 65280 F11 Sample 71 BLANK 0
TRUE 65280 F12 Sample 72 BLANK 0
TRUE 65280 G1 Sample 73 NTC 0
TRUE 65280 G2 Sample 73 NTC 0
TRUE 65280 G3 Sample 73 NTC 0

Averages

TS standard curve averages
Standard TS Average TS StDev
1 30.67666667 0.134288247
5 27.82333333 0.049328829
10 26.50333333 0.045092498
15 25.80333333 0.170098011
20 24.50666667 0.283078317
25 23.05 0.320780299
VWR standard curve averages
Standard VWR Average VWR StDev
1 29.93666667 0.817944578
5 27.42333333 0.122202019
10 25.525 0.16263456
15 25.74666667 0.112398102
20 24.04666667 0.100166528
25 23.83666667 0.292631737

07112016_CompareProKBrandgraph

After precipitating the DNA and running with qPCR on the samples and comparing them to the previous run when DNA was not precipitated it appears that the samples amplified later in the run. But there still seems no difference between the two proK brands (orange represents the VWR brand and the blue represents the ThermoScientific brand). VWR brand still seems to be more sensitive with this run which was also seen with the previous run.

Running Qubit (after qPCR)

  • After qPCR was finished, took out plate and used reactions in wells associated with column 3 and 7 to apply to Qubit to get final concentration of DNA after running qPCR.
  • Added 20 ul of these reactions to the associated labeled tubes and read the samples following the same steps as done on reading them before qPCR.
  • There was not enough volume to reach the 20ul in samples Column 7 A and B but ran with what they had anyway.
Brand ProK Standard Qubit after qPCR 07112016_[DNA] (ng/ml)_sample ng/ul
Thermo Scientific 1 4860 4.86
Thermo Scientific 1 4850 4.85
Thermo Scientific 1 4840 4.84
Thermo Scientific 5 4930 4.93
Thermo Scientific 5 4930 4.93
Thermo Scientific 5 4920 4.92
Thermo Scientific 10 887 0.887
Thermo Scientific 10 884 0.884
Thermo Scientific 10 882 0.882
Thermo Scientific 15 4960 4.96
Thermo Scientific 15 4960 4.96
Thermo Scientific 15 4960 4.96
Thermo Scientific 20 4990 4.99
Thermo Scientific 20 4980 4.98
Thermo Scientific 20 4980 4.98
Thermo Scientific 25 4940 4.94
Thermo Scientific 25 4940 4.94
Thermo Scientific 25 4940 4.94
VWR 1 4670 4.67
VWR 1 4660 4.66
VWR 1 4660 4.66
VWR 5 4990 4.99
VWR 5 4980 4.98
VWR 5 4980 4.98
VWR 10 4830 4.83
VWR 10 4830 4.83
VWR 10 4830 4.83
VWR 15 5000 5
VWR 15 5000 5
VWR 15 5000 5
VWR 20 4870 4.87
VWR 20 4870 4.87
VWR 20 4870 4.87
VWR 25 5100 5.1
VWR 25 5100 5.1
VWR 25 5100 5.1
NTC NTC 905 0.905
NTC NTC 905 0.905
NTC NTC 904 0.904
  • Determined the % increase of DNA concentration by calculating
  • (([final]-[initial])/[final]) *100
  • Percent increase in DNA concentration is listed below.
  • Almost all of the reactions had >80 percent increase in concentration after qPCR.
Brand ProK Standard % increase
Thermo Scientific 1 82.26337449
Thermo Scientific 1 82.24742268
Thermo Scientific 1 82.23140496
Thermo Scientific 5 83.32657201
Thermo Scientific 5 83.32657201
Thermo Scientific 5 83.31300813
Thermo Scientific 10 9.470124014
Thermo Scientific 10 9.2760181
Thermo Scientific 10 9.183673469
Thermo Scientific 15 82.64112903
Thermo Scientific 15 82.66129032
Thermo Scientific 15 82.68145161
Thermo Scientific 20 #VALUE!
Thermo Scientific 20 #VALUE!
Thermo Scientific 20 #VALUE!
Thermo Scientific 25 83.07692308
Thermo Scientific 25 83.07692308
Thermo Scientific 25 83.11740891
VWR 1 81.28479657
VWR 1 81.43776824
VWR 1 81.52360515
VWR 5 82.98597194
VWR 5 82.97188755
VWR 5 83.01204819
VWR 10 81.8426501
VWR 10 81.88405797
VWR 10 81.9047619
VWR 15 83.18
VWR 15 83.2
VWR 15 83.24
VWR 20 82.27926078
VWR 20 82.32032854
VWR 20 82.38193018
VWR 25 82.62745098
VWR 25 82.70588235
VWR 25 82.76470588
NTC NTC 6.187845304
NTC NTC 6.629834254
NTC NTC 6.747787611

PCR was also preformed on the remaining qPCR replicates. to do this we added the use of loading dye. To run gel,  independently placed two 1.2% agarose gel made with 1X TAE buffer into 2 gel boxes and poured 1X TAE buffer into gel box over molds until the mold was completely covered. Pipetted out 10ul of 1000bp low range ladder and added to first well. Used loading dye 1:1 with each sample so that there was a total of 10ul for each well. Pipetted 5ul of each reaction into a PCR plate in the same position as original plate layout so to not confuse myself. To the 5ul sample added 5ul of loading dye. Pipetted up and down to mix. Pipetted out the resulting 10ul reactions and added to respective well as diagramed above. Ran electrophoresis at 100V for 30 min. We were able to see clear amplified product on the resulting gels.

Gel #15 (below) ThermoScientific Precipitated qPCR ProK Gel
Reactions showing from L –> R as follows:
Row 1- L NTC 1SC 1SC 5SC 5SC 10SC 10SC 15SC 15SC 20SC 20SC
Row 2- L NTC 25SC 25SC
Amplified product detected in all reactions with exception to NTC.

07122016_TS_ProK_Precipitate_qPCR.jpg

Gel #16 (below) VWR Precipitated qPCR ProK Gel
Reactions showing from L –> R as follows:
Row 1- L NTC 1SC 1SC 5SC 5SC 10SC 10SC 15SC 15SC 20SC 20SC
Row 2- L NTC 25SC 25SC
Amplified product detected after using electrophoresis on qPCR reactions with exception to NTC.
07122016_VWRProKPrecipitate_qPCR
We also ran the eukaryotic primers (EukA    CTGGTTGATCCTGCCAG;  EukB    TGATCCTTCYGCAGGTTC) that Sam suggested on the 8 Fidalgo Bay samples that we identified should have DNA in them. When these gels were run all showed some light amplification including the NTC which indicated that we had contamination. These will be run again. However, electrophoresis is definitely working as we can see using the qPCR reactions so the PCR methods must be having issues at the thermocycler stage.  Maybe this is what the issue is when running PCR to test DNA presence in our Fidalgo Bay samples. Testing the PCR method was the next problem worked out.
Testing PCR settings

Making 1.2% agarose gels using 1X TAE buffer for PCR

  • Want three gels so going to make a total of 450ml of agarose so that there wil be more than enough to run with.
  • Need 450ml of 1XTAE Buffer
  • Need 5.4g of Agarose chem
  • Need 45ul of Ethedium Bromide
  • Cleaned gel molds and comb rows with ultra pure water and put molds in gel lanes in prep for making the gels.
  • triple rinsed a 100ml graduated cylinder and 1000ml Erlenmeyer flask.
  • Added 400 ml of the 1X TAE buffer to the flask.
  • Measured out the agarose powder (actual mass= 5.404g) onto a weighboat in a tared three place balance.
  • Poured dry chemical into flask with the buffer in it.
  • Measured out final volume (50ml) of 1X TAE buffer and used it to rinse the weigh boat.
  • Swirled solution and microwaved for 4 minutes, until the agarose completely dissolved into buffer.
  • Pipetted out 45ul of ethedium bromide and aded to solution.
  • Poured solution into three molds and used pipette tip to push all bubbles to the side of the mold or pop them so they wouldn’t interfere with electrophoresis.
  • Allowed molds to cool.

Thermocycler test

Setting up Thermocyclers

  • Changed presets on Thermocycler 2 to so that the cycles are as listed below which would allow match of qPCR settings:

Thermocycler 2 was set so the the cycles were as listed below:

95C for 10minutes
95C for 2min 30sec (X40)
60C for 20sec (X40)
60C for 30sec (X40)
72C for 2minutes
4C for holding

Thermocycler 1 was set so the the cycles were as listed below:

95oC-10min
40 cycles of:
95oC-20sec
65oC-20sec
72oC-30sec
72oC-2min
4oC- Hold For Ever
  • For the step (65oC-20sec) this deviated from where Sam had us running which was 55C for 20 seconds. Changed this setting back to 55C. This could have been the issue all along.
  • Thermocycler 1 now reads so that the cycler parameters are:
Thermocycler 1
95oC-10min
40 cycles of:
95oC-20sec
55oC-20sec
72oC-30sec
72oC-2min
4oC- Hold For Ever

Master mix prep

  • We will be using the same Precipitated TS brand standard curve samples that we used during qPCR.
  • Decided to just run the TS standards to limit the amount of ingredients we need to use . Also decided to do this since so far each brand has had minimal differences so either one should work for this test.
  • NTC will be prepared with molecular water.
  • 18TC sample that contains adult Oly DNA as a positive control.
  • The samples will be run in duplicate with exception to the TC which will be a single reaction on each gel.
  • Total of 30 samples will be prepared and run.
  • Master mix was prepared using the following volumes.
Ingredient Standard Volume (ul) Number of samples (#) V*# (V*#)*10%Error Total Volume (ul)
Master mix 12.5 30 375 37.5 412.5
Fwd Primer 0.5 30 15 1.5 16.5
Rev Primer 0.5 30 15 1.5 16.5
Water 9.5 30 285 28.5 313.5

 

  • Master mix was prepped by first adding the 2X green taq mix, then FWD and REV primers which were already aliquoted from 07112016 qPCR run and then water was added to complete the mix.
  • The mix was inverted to mix and centrifuged down to isolate solution to the bottom of eppendorf tube.
  • The standards were thawed finger vortexed to homogonize and then centrifuged down to isolate the sample.
  • 8strip tubes were labeled and prepared for PCR by adding 23ul of master mic followed by 2ul of respective sample then centrifuged down.
  • The samples were placed in their respective thermocyclers and ran each program.

Electrophoresis

Placed a gel into two gel boxes and filled gel box with 1X TAE buffer until the solution just covered the gels.

Added 10ul of ladder to the first well and then 10 ul of respective reaction the the remaining wells that were to be used using the following diagram:

Gel #17 1 2 3 4 5 6 7 8 9 10 11 12
Row 1 L N TS1OlySC TS1OlySC TS10OlySC TS10OlySC TS15OlySC TS15OlySC TS20OlySC TS20OlySC TS25OlySC TS25OlySC
Row 2 L N TS5OlySC TS5OlySC 18tc
Gel #18 1 2 3 4 5 6 7 8 9 10 11 12
Row 1 L N TS1OlySC TS1OlySC TS10OlySC TS10OlySC TS15OlySC TS15OlySC TS20OlySC TS20OlySC TS25OlySC TS25OlySC
Row 2 L N TS5OlySC TS5OlySC 18tc

Ran electrophoresis at 100V for 30 min. The results, below, show both methods worked just fine which we did not get when we ran these standards before on PCR. It could be that correcting Thermocycler 1 to be 55C instead of 65C made the difference in getting PCR working. It could also be that precipitating the DNA made things work out. Because the PCR issue seems to be fixed now and because when we ran the eukaryotic primers before there was contamination, we decided to run them again and make sure everything is completely sterile. We also wanted to test the Oly primers on the same samples.

Running PCR on Eukaryotic primers and Oly primers

Used Fidalgo Bay samples that we have been working with that contained Oly larvae in them (by visual confirmation). These samples are listed below- the numbers associated with the samples denote where they are in the layouts for the gels below.

Tube # Sample ID
28 S1A_S_7/11-18/13_2
39 S1A_B_7/11-18/13_2
50 S1A_S_7/11-18/13_3
61 S1A_B_7/11-18/13_3
68 S1A_S_5/10-16/13_2
69 S1A_B_5/2-10/13_2
72 S1A_S_5/10-16/13_3
73 S1A_B_5/2-10/13_3
    Running Oly primers on Fidalgo Bay samples
  • Will run these samples in duplicate
  • Will also run 2 NTC using molecular water as template.
  • Will run the precipitated TS25OlySC sample as a positive control.
  • Total of 20 samples will be run on a single gel.
  • Using the volumes below I made the master mix:
Ingredient Standard Volume (ul) Number of samples (#) V*# (V*#)*10%Error Total Volume (ul)
Master mix 12.5 20 250 25 275
Fwd Primer 0.5 20 10 1 11
Rev Primer 0.5 20 10 1 11
Water 9.5 20 190 19 209
  • To make the mix I first added the master mixfollowed by the same FEW and REV primers that I used in the above thermocycler test (there was still some left over from the previous aliquot from 07112016 qPCR run) and finished the solution by adding molecular water.
  • Inverted the solution to mix well and centrifuged to isolate the liquid to the bottom of the tube. The samples were already thawed from being set out prior to starting the mix (used the 20ul aliquots that were made previously form the original samples).
  • Set out and labeled 8-strip PCR tubes and caps.
  • Added 23ul of the master mix to each tube followed by 2u of the respective sample.
  • Centrifuged down and set in Thermocycler 1 along with the eukaryotic samples to undergo PCR.

Eukaryotic primers on Fidalgo Bay samples

  • For these samples we will also test them using the loading dye as well as with out just to make sure that adding a loading dye isn’t the issue we are having when we aren’t seeing amplification.
  • Again, since we’re working with a very sensitive primer, I sterilized every utensil I would need for the procedure by placing under the UV light for 30 minutes. Since, at the end of 30 minutes this will be a sterile work space too, I will continue the rest of the work under the tank. Materials included:
    • Each 8 strip tube I would need (3) along with each of their tops (3).
      • Each strip was stood up and left unopened and exposed to the UV light, while each strip lid was left upside-down so that the inside of the tube would remain sterile.
    • Pipettes (just to be overcautious)
      • 10ul, 100ul, and 1000ul
    • Pipette tips (just to be overcautious)
      • Left in their containers with the lid closed.
      • 10ul, 100ul, and 1000ul
    • 2ml tube for nuclease free water (used for aliquoting primers and making the mix)
      • Left opened and stood up.
    • 2ml tube for final master mix
      • Left opened and stood up.
    • Two 2ml tubes for the forward and reverse primers after aliquoting.
      • Left opened and stood up.
    • Tip waste, (just to be overcautious).
  • Aliquoted the primers, knowing that their initial concentration was 100uM, I needed the final concentration to be 10uM, and that I would need 15ul final for each (I did the calculations for the master mix below first to see how much of each primer I would need, then I rounded to account for error).
    • 100uM*X=10uM*15ul
    • X=1.5ul of primer added to 13.5ul of water (15-1.5=13.5)
  • Created a master mix using the following calculations:
    • 8 samples (28, 39, 50, 61, 68, 69, 72, 73) duplicated on the gel is 16 slots, in addition to 2 ladders, 2NTCs, and 2TC (sample 18 DNR), there will be a total of 22 samples.
    • Ingredient Stnd Vol (ul) # samples vol*# samples 10% error Total+10% error
      Green Mix 12.5 22 275 27.5 302.5
      FWD 0.5 22 11 1.1 12.1
      REV 0.5 22 11 1.1 12.1
      Water 9.5 22 209 20.9 229.9
    • Added each in the order they appear to a 2ml tube and inverted to make sure it was homogenous.
  • Pipette 23ul of master mix into each tube on the 8-strip tubes, followed by 2ul of the assigned template (whether a sample or water for NTC/TC).
      • Before pipetting, the master mix or each sample was inverted or finger vortexed.

Thermocycler parameters are as listed below.

95oC-10min
40 cycles of:
95oC-20sec
55oC-20sec
72oC-30sec
72oC-2min
4oC- Hold For Ever

Prep of three more gels for electrophoresis

  • I measured 300ml of 1.0 TBE in a graduated cylinder (100ml at a time) and poured into a volumetric flask (leaving some out to wash out the weighboat of agarose powder).
  • I then measured 3.6g (actual weight 3.601g) of agarose powder (1.2g per 100ml) and poured into the volumetric flask, rinsing the weighboat with the extra buffer solution.
  • Put a kimwipe into the mouth of the Erlenmeyer flask and microwaved for 1 minute, 1 minute, and then every 10 seconds until all the agarose was dissolved, making sure to swirl the flask with each set.
    • Made sure to wear autoclave gloves and held away from face.
    • Monitored the mixture closely, making sure it did not boil over.
  • Once done cooking, I added syberSAFE dye (1:10,000=10ul per 100ml).
  • After letting cool for about 5 minutes, I poured the gel into two gel trays and then continued to let it cool into form.

Electrophoresis

  • Once the thermocycler was done, the strip tubes were taken out and loaded onto the gels according to the layout below:
    • Gel layout for the samples that I’ve done here will be as follows:
      Gel #19 1 2 3 4 5 6 7 8 9 10 11 12
      Row 1 L N 28 28 39 39 50 50 61 61 68 68
      Row 2 L N 69 69 72 72 73 73 TS25OlySC TS25OlySC
    • Gel W/OUT DYE 1 2 3 4 5 6 7 8 9 10 11 12
      TOP L TC NTC 28 28 39 39 50 50 61 61
      BOTTOM L TC NTC 68 68 69 69 72 72 73 73
      Gel W/ DYE 1 2 3 4 5 6 7 8 9 10 11 12
      TOP L TC NTC 28 28 39 39 50 50 61 61
      BOTTOM L TC NTC 68 68 69 69 72 72 73 73
    • For the set with loading dye, I did a 1:4 ratio:
      • Pipetted 7.5ul of each sample into a new tube strip tube, then 2.5ul of loading dye into the sample tube (total 10ul). THEN loaded into the gel wells.
    • For the regular gels without loading dye being added, 10ul of the sample was pipetted into the well.
  • Gels were set to run for 30 minutes at 100V.

Results

Gel #19 (below) Fidalgo Bay samples Run with Oly Primers
Reactions showing from L –> R as follows:
Row 1- L NTC 28 28 39 39 50 50 61 61 68 68
Row 2- L NTC 69 69 72 72 73 73 TSOly25SC TSOly25SC
Amplified product detected only on the TSOly25SC

07132016_PCR_OlyFidalgoBay2013SampleTest

Gel (below) Fidalgo Bay samples WITH dye test run with eukaryotic primers
Reactions showing from L –> R as follows:
Row 1- L TC NTC 28 28 39 39 59 59 61 61
Row 2- L TC NTC 68 68 69 69 72 72 73 73
No amplified product shows- only ladder ; no amplified product for the TC either though
07132016_FidalgoBay2013_WithDyeTEST.JPG
Gel (below) Fidalgo Bay samples WITHOUT dye test run with eukaryotic primers
Reactions showing from L –> R as follows:
Row 1- L TC NTC 28 28 39 39 59 59 61 61
Row 2- L TC NTC 68 68 69 69 72 72 73 73
No amplified product shows- only ladder; this includes the TC
07132016_PCR_FidalgoBay2013Samples_WithOutDyeTEST.JPG
In summary, I’m not sure the eukaryotic primers are working since they aren’t amplifying on the template control which is DNA from an adult Olympia oyster. It could be that that sample no longer has DNA in it, but I don’t think this is likely. We could try again and use one of the precipitated standards as a TC to test the primers. Either that or the samples have degraded and we need to move onto hand counts.
Precipitating the DNA in the standards seemed to work well. I was thinking that that would be the next step but I want to test it with the 8 samples that we’ve been using for tests first.
We could also try extracting DNA from the other half of the original samples and using the DNA kit for extraction.
michellenegron 10:00 PM on February 13, 2016  

DNR Geoduck Project: Michelle McCartha

SAFS- Roberts Lab
McCartha Hintz Fowler Axton and Jenn
01/15/16 Running standard curve on C. gigas
Created by Michelle McCartha
Goal:
1-To train the students in making and running reactions for qPCR
2- To run standards curve.
Methods:
Aliquoting primers and probe
Probes and primers were aliquoted into 100Microliter 10micromolar concentrations using molecular water.
Each student was responsible for aliquoting one of the primers or probe.
  C1V1=C2V2
     (100µM)(x)=(10µM)(100µL)x=10µL of each primer 
     100µL aliquot-10µL primer=90µL of nuclease free water
Added water then Primer stock solution and pipetted up and down to mix.
Inverted tubes and finger vortexed then centrifuged.
*Need to start making premade aliquots of the primers/probe so that we don’t have to keep freezing and thawing them.

Preparing master mix

Master mix for C. gigas was prepared by Michelle to save on time but was explained as we went.
Mix was prepared by first adding the IQ Powermix, then FWD/REV primers and lastly probe.
*Brent came to visit during plate preparation and advised on how to make the reactions more precise and accurate. We can do this by adding water to the mix as it should be added. We will incorporate this step into future methods.
The following volumes comprised the master mix.
Master Mix Solutions Standard volume (μL) Multiply By new volume * 10% pipette error add  pipette error Final volume to add (μL)
Master mix 25 50 1250 125 1375 1375
FWD Primer 1.5 50 75 7.5 82.5 82.5
Rev Primer 1.5 50 75 7.5 82.5 82.5
Probe 1 50 50 5 55 55
Plate set up
When finished the students finished thawing out the samples for the standard curve. All samples are using 10 day old C gigas larvae in increments of either 1, 5, 10, 25, 50. There are three standard curves to run and these “bio” reps will be run in triplicate. Ashley will set up the plate for all three technical reps for bio 1 curve, Jenn will set up the reps for Bio 2 curve and Axton will set up the reactions for the Bio 3 curve.
The plate was set up as follows:
1 2 3 4 5 6 7 8 9 10 11 12
A NTC 1PCg5 1PCg1 1PCg1 2Cg1 2Cg1 2Cg1 3Cg1 3Cg1 3Cg1
B NTC 1Cg1 1Cg5 1Cg5 2Cg5 2Cg5 2Cg5 3Cg5 3Cg5 3Cg5
C NTC 1Cg10 1Cg10 1Cg10 2Cg10 2Cg10 2Cg10 3Cg10 3Cg10 3Cg10
D NTC 1Cg25 1Cg25 1Cg25 2Cg25 2Cg25 2Cg25 3Cg25 3Cg25 3Cg25
E TC 1Cg50 1Cg50 1Cg50 2Cg50 2Cg50 2Cg50 3Cg50 3Cg50 3Cg50
F
G
H
Sample reactions were made by first adding 29μL of the mix, followed by 4μL of the template and finally 17μL of molecular water.
NTC was made by adding 29μL of mix and 21μL of water
TC was made by adding 29μL of the mix, followed by 4μL of the template and finally 17μL of molecular water. Template for TC was from 25 18 day old C. gigas larvae.
There was only one mix up which was on A1 and A2. These standards were flipped.
When the students were finished with the plate, the lids were double checked that they were capped and then the plate was centrifuged for 1 min at 2000RPM.
Running qPCR
Plate was run at the following parameters:
    • Incubate 95C for 2 minutes 30 seconds
    • Incubate 95C for 30 seconds
    • Incubate 60C for 50 seconds
    • Plate read
    • Go to step 2, 39 more times

Saved tad file as 20160115_144909

Results
All standard curve data is attached including for this curve.
michellenegron 9:58 PM on February 13, 2016  

DNR Geoduck Project: Michelle McCartha

SAFS-Roberts Lab
McCartha
1-29-16- Re-run geoduck standard curve to test for machine precision
Created by Michelle McCartha
Goal: to determine if a standard curve should be run on every plate and on each day of the run, we want to test the precision of the qPCR machine. To do this the exact same methods will be used as were used on 1/28/16 when the original curve was run. This data will then be compared.
Methods:
Geoduck samples we set out to thaw.
Probes and primers were aliquoted into 100Microliter 10micromolar concentrations using molecular water.
10microliter primer and probe with 90 microliter molecular water respectively. These were mixed using pipette and centrifuged down.
Prepared master mix using a sterile 15ml centrifuge tube using volumes calculated below.
Master Mix Solutions Standard volume (μL) Multiply By new volume * 10% pipette error add  pipette error Final volume to add (μL)
Master mix 25 50 1250 125 1375 1375
FWD Primer 1.5 50 75 7.5 82.5 82.5
Rev Primer 1.5 50 75 7.5 82.5 82.5
Probe 1 50 50 5 55 55
Water 17 50 850 85 935 935
Added super mix first then primers and probe followed by water.
Finished Thawing standard curve samples by hand friction.
Pulled clean 96-well plate and caps. caped all rows that we are going to use.
Prepared plate by adding sample first then topping off with mix.
Continuing with 50 microliter reactions so added 4 microliters sample and 46 microliters master mix.
Prepare NTC first by adding 46 microliters master mix following the 4 microliter water for no template.
Capped these reactions before moving onto samples and template control.
Template control was added by adding 4 microliters template control adn 46 microliters master mix.
Lay out for all reactions below.
1 2 3 4 5 6 7 8 9 10
A NTC 1Pg1 1Pg1 1Pg1 2Pg1 2Pg1 2Pg1 3Pg1 3Pg1 3Pg1
B NTC 1Pg5 1Pg5 1Pg5 2Pg5 2Pg5 2Pg5 3Pg5 3Pg5 3Pg5
C NTC 1Pg10 1Pg10 1Pg10 2Pg10 2Pg10 2Pg10 3Pg10 3Pg10 3Pg10
D NTC 1Pg25 1Pg25 1Pg25 2Pg25 2Pg25 2Pg25 3Pg25 3Pg25 3Pg25
E TC 1Pg50 1Pg50 1Pg50 2Pg50 2Pg50 2Pg50 3Pg50 3Pg50 3Pg50
F
G
H
When all reactions were prepared, centrifuged for 1 min at 2000RPM.
Took to qPCR machine and ran curve under the following program parameters.

Step 1) 95.0°C-10 minutes

Step 2) 95.0°C-20 seconds

Step 3) 65°C-20 seconds

Step 4) 72°C-30 seconds

Step 5) Repeat steps 2-4 39 more times (40 times total)

Step 6) 72°C-2 minutes

Step 7) Hold at 4°C forever

Saved file as tad file: 20160129_124635
Results
All standard curve data including for this one is attached.
michellenegron 9:55 PM on February 13, 2016  

DNR Geoduck Project: Michelle McCartha

SAFS- Roberts Lab
McCartha
1/28/16 Re-do geoduck curve with proper technique for master mix
Created by McCartha
Goal- Previously, the master mix was prepared with out adding water to the mix, instead adding water to each individual reaction. This may have effected the resulting curve during qPCR. Today, the mix will be prepared using the correct technique and we should see greater replicate precision.
Methods-
Geoduck samples we set out to thaw.
Probes and primers were aliquoted into 100Microliter 10micromolar concentrations using molecular water.
10microliter primer and probe with 90 microliter molecular water respectively. These were mixed using pipette and centrifuged down.
Prepared master mix using a sterile 15ml centrifuge tube using volumes calculated below.
Master Mix Solutions Standard volume (μL) Multiply By new volume * 10% pipette error add  pipette error Final volume to add (μL)
Master mix 25 50 1250 125 1375 1375
FWD Primer 1.5 50 75 7.5 82.5 82.5
Rev Primer 1.5 50 75 7.5 82.5 82.5
Probe 1 50 50 5 55 55
Water 17 50 850 85 935 935
Added super mix first then primers and probe followed by water.
Finished Thawing standard curve samples by hand friction.
Pulled clean 96-well plate and caps. caped all rows that we are going to use.
Prepared plate by adding sample first then topping off with mix.
Continuing with 50 microliter reactions so added 4 microliters sample and 46 microliters master mix.
Prepare NTC first by adding 46 microliters master mix following the 4 microliter water for no template.
Capped these reactions before moving onto samples and template control.
Template control was added by adding 4 microliters template control adn 46 microliters master mix.
Lay out for all reactions below.
1 2 3 4 5 6 7 8 9 10
A NTC 1Pg1 1Pg1 1Pg1 2Pg1 2Pg1 2Pg1 3Pg1 3Pg1 3Pg1
B NTC 1Pg5 1Pg5 1Pg5 2Pg5 2Pg5 2Pg5 3Pg5 3Pg5 3Pg5
C NTC 1Pg10 1Pg10 1Pg10 2Pg10 2Pg10 2Pg10 3Pg10 3Pg10 3Pg10
D NTC 1Pg25 1Pg25 1Pg25 2Pg25 2Pg25 2Pg25 3Pg25 3Pg25 3Pg25
E TC 1Pg50 1Pg50 1Pg50 2Pg50 2Pg50 2Pg50 3Pg50 3Pg50 3Pg50
F
G
H
When all reactions were prepared, centrifuged for 1 min at 2000RPM.
Took to qPCR machine and ran curve under the following program parameters.

Step 1) 95.0°C-10 minutes

Step 2) 95.0°C-20 seconds

Step 3) 65°C-20 seconds

Step 4) 72°C-30 seconds

Step 5) Repeat steps 2-4 39 more times (40 times total)

Step 6) 72°C-2 minutes

Step 7) Hold at 4°C forever

Saved file as tad file: 20160128_142551
Results
Data file attached has results from all curves including this one.
michellenegron 11:14 PM on February 12, 2016  

DNR Geoduck Project- Michelle McCartha

SAFS- Roberts Lab
McCartha
02/05/16 Running Vp standard curve
Created by Michelle McCartha
Goal: To test complete set of the standard curve and determine if the primers and probe and curve are ready for running samples.
Methods:
Aliquoting primers and probe
C1V1=C2V2
     (100µM)(x)=(10µM)(100µL)x=10µL of each primer 
     100µL aliquot-10µL primer=90µL of nuclease free water
Added water then Primer stock solution and pipetted up and down to mix.
Inverted tubes and finger vortexed then centrifuged.
 
Master mix prep
Took out samples and allowed to thaw while making master mix. 
To make the master mix, the following volumes were used…including water in the master mix.
 
Master Mix Solutions Standard volume (μL) Multiply By new volume * 10% pipette error add  pipette error Final volume to add (μL)
Master mix 25 50 1250 125 1375 1375
FWD Primer 1.5 50 75 7.5 82.5 82.5
Rev Primer 1.5 50 75 7.5 82.5 82.5
Probe 1 50 50 5 55 55
Water 17 50 850 85 935 935
 
Water was added to the mix in accordance with the new method protocol.
To make the master mix, a 15ml centrifuge tube was used. The IQ Powermix was added first, followed by the FWD/REV primers and probe and finally the molecular water. 
The mix was finger vortexed as well as pipetted up and down to allow homogeneity. 
 
Plate Set up 
Set up for the plate is as follows:
 
1 2 3 4 5 6 7 8 9 10 11
A NTC 1Vp1 1Vp1 1Vp1 2Vp1 2Vp1 2Vp1 3Vp1 3Vp1 3Vp1
B NTC 1Vp5 1Vp5 1Vp5 2Vp5 2Vp5 2Vp5 3Vp5 3Vp5 3Vp5
C NTC 1Vp10 1Vp10 1Vp10 2Vp10 2Vp10 2Vp10 3Vp10 3Vp10 3Vp10
D NTC 1Vp25 1Vp25 1Vp25 2Vp25 2Vp25 2Vp25 3Vp25 3Vp25 3Vp25
E TC 1Vp50 1Vp50 1Vp50 2Vp50 2Vp50 2Vp50 3Vp50 3Vp50 3Vp50
F
G
H
Sample reactions were made by adding 46μL of the master mix followed by 4μL of the template.  
NTC was made by adding 46μL of master mix followed by 4μL of water
TC was made using 25 18-day manilla clams digested in 1ml Prok solution as all samples were digested. 
TC reactions were made by adding 46μL of the master mic followed by 4μL of the template. 
When all the reactions were prepped, checked to make sure the caps were on securely and centrifuged for 1 min at 2000RPM.
qPCR parameters
Plate was run at the following parameters:
    • Incubate 95C for 2 minutes 30 seconds
    • Incubate 95C for 30 seconds
    • Incubate 60C for 50 seconds
    • Plate read
    • Go to step 2, 39 more times

Saved tad file as 20160205_150807

Results:

Manila clam standard curve data is in the attached excel file.
 
 
 
 
michellenegron 10:54 PM on February 12, 2016  

DNR Geoduck Project- Michelle McCartha

SAFS- Roberts Lab
McCartha
12/10/15 Oly Standard Curve 1
Created by: Michelle McCartha
Goal: Want to run the OLY standard curve today to test curve and then will run again for repeatability tomorrow.
Methods:
Aliquoting primers and probe
C1V1=C2V2
     (100µM)(x)=(10µM)(100µL)x=10µL of each primer 
     100µL aliquot-10µL primer=90µL of nuclease free water
Added water then Primer stock solution and pipetted up and down to mix.
Inverted tubes and finger vortexed then centrifuged.

Took out all samples to be thawed out. Used hand friction to assist thawing as necessary.

Preparing master mix
Mix was made by adding the IQpowermix, followed by FWD/REV primers and probe.
Once all components of the mix was added, the tube was inverted and liquid pipetted up and down for mixing.
Master Mix Solutions Standard volume (μL) Multiply By new volume * 10% pipette error add  pipette error Final volume to add (μL)
Master mix 25 50 1250 125 1375 1375
FWD Primer 1.5 50 75 7.5 82.5 82.5
Rev Primer 1.5 50 75 7.5 82.5 82.5
Probe 1 50 50 5 55 55
Preparing Plate
Plate setup will as specified below.
1 2 3 4 5 6 7 8 9 10
A NTC 1Oly1 1Oly1 1Oly1 2Oly1 2Oly1 2Oly1 3Oly1 3Oly1 3Oly1
B NTC 1Oly5 1Oly5 1Oly5 2Oly5 2Oly5 2Oly5 3Oly5 3Oly5 3Oly5
C NTC 1Oly10 1Oly10 1Oly10 2Oly10 2Oly10 2Oly10 3Oly10 3Oly10 3Oly10
D NTC 1Oly25 1Oly25 1Oly25 2Oly25 2Oly25 2Oly25 3Oly25 3Oly25 3Oly25
E TC 1Oly50 1Oly50 1Oly50 2Oly50 2Oly50 2Oly50 3Oly50 3Oly50 3Oly50
F
G
H
For all reactions, the mix was placed in the well first followed by the template/standard/water (NTC)
For all reactions, volume was brought to 50 microliters with water at the plate stage, not mixed in the master mix directly.
TC was made up of 25 larvae
 
qPCR parameters
Plate was run at the following parameters:
    • Incubate 95C for 2 minutes 30 seconds
    • Incubate 95C for 30 seconds
    • Incubate 60C for 50 seconds
    • Plate read
    • Go to step 2, 39 more times
Saved file as tad 20151210_130740
Results and data on the Oly 1 standard curve are in the attached excel file.
michellenegron 10:39 PM on February 12, 2016  

DNR Geoduck Project- Michelle McCartha

SAFS- Roberts Lab
McCartha
12/10/15 Oly and Pg Standard Curve 1
Created by: Michelle McCartha
Goal: Want to run the OLY and Pg standard curves today to test curve and then will run again for repeatability tomorrow.
Methods:
Aliquoting primers and probe
C1V1=C2V2
     (100µM)(x)=(10µM)(100µL)x=10µL of each primer 
     100µL aliquot-10µL primer=90µL of nuclease free water
Added water then Primer stock solution and pipetted up and down to mix.
Inverted tubes and finger vortexed then centrifuged.

Took out all samples to be thawed out. Used hand friction to assist thawing as necessary.

Preparing master mix
Mix was made by adding the IQpowermix, followed by FWD/REV primers and probe.
Once all components of the mix was added, the tube was inverted and liquid pipetted up and down for mixing.
Master Mix Solutions Standard volume (μL) Multiply By new volume * 10% pipette error add  pipette error Final volume to add (μL)
Master mix 25 50 1250 125 1375 1375
FWD Primer 1.5 50 75 7.5 82.5 82.5
Rev Primer 1.5 50 75 7.5 82.5 82.5
Probe 1 50 50 5 55 55
Preparing Plate
Plate setup will as specified below.
1 2 3 4 5 6 7 8 9 10
A NTC 1Oly1 1Oly1 1Oly1 2Oly1 2Oly1 2Oly1 3Oly1 3Oly1 3Oly1
B NTC 1Oly5 1Oly5 1Oly5 2Oly5 2Oly5 2Oly5 3Oly5 3Oly5 3Oly5
C NTC 1Oly10 1Oly10 1Oly10 2Oly10 2Oly10 2Oly10 3Oly10 3Oly10 3Oly10
D NTC 1Oly25 1Oly25 1Oly25 2Oly25 2Oly25 2Oly25 3Oly25 3Oly25 3Oly25
E TC 1Oly50 1Oly50 1Oly50 2Oly50 2Oly50 2Oly50 3Oly50 3Oly50 3Oly50
F
G
H
For all reactions, the mix was placed in the well first followed by the template/standard/water (NTC)
TC was made up of 25 larvae
For all reactions volume was brought up to 50 microliters with water- water was not added to the master mix directly.
 
qPCR parameters
Plate was run at the following parameters:
    • Incubate 95C for 2 minutes 30 seconds
    • Incubate 95C for 30 seconds
    • Incubate 60C for 50 seconds
    • Plate read
    • Go to step 2, 39 more times
Saved file as tad. 20151211_143614
Results
All standard curve data is in the attached excel file including from this run.
michellenegron 10:18 PM on February 12, 2016  

DNR Geoduck Project- Michelle McCartha

SAFS- Roberts Lab
McCartha
02/08/16 Running other two size classes of C. gigas for comparison
Created by: Michelle McCartha
Goal:
In literature, a difference in amplification has been noted when comparing different size classes of the same species using qPCR due to sensitivity and there being more genetic material at different stages of species maturity. To investigate this further and confirm if or not we need to consider size fractions of our species when processing samples, a test will be done using the three age classes of C. gigas that we have in stock. These size classes include 18-day old, 10-day old and 3-day old larvae. We currently have three bio reps prepared and already digested using te ProK method that we have been using. We already have a curve for the 10-day old age class, so today only the 3-day old and the 18-day old will be run using all three sets of standard curves in triplicate.
Methods:
Aliquoting primers and probe
C1V1=C2V2
     (100µM)(x)=(10µM)(200µL)x=20µL of each primer 
     200µL aliquot-10µL primer=180µL of nuclease free water
Added water then Primer stock solution and pipetted up and down to mix.
Inverted tubes and finger vortexed then centrifuged.

Took out all samples to be thawed out. Used hand friction to assist thawing as necessary.

Preparing master mix
Only one master mix needs to be prepared for this set since we are working with the same species.
The reactions will be run using the same 50 microliter volume as done with the previous C. gigas curve for consistency.
Mix was made by adding the IQpowermix, followed by FWD/REV primers and probe and lastly with water.
The mix was made in a 15ml sterile centrifuge tube.
Once all components of the mix was added, the tube was inverted and liquid pipetted up and down for mixing.
Master Mix Solutions Standard volume (μL) Multiply By new volume * 10% pipette error add  pipette error Final volume to add (μL)
Master mix 25 100 2500 250 2750 2750
FWD Primer 1.5 100 150 15 165 165
Rev Primer 1.5 100 150 15 165 165
Probe 1 100 100 10 110 110
Water 17 100 1700 170 1870 1870
Preparing Plate
Two plates will be run- one for the 18-day old and one for the 3-day old larvae age classes. Even thought they will have different plates, the plates will be set up the same for each run as specified below.
1 2 3 4 5 6 7 8 9 10
A NTC 1Cg1 1Cg1 1Cg1 2Cg1 2Cg1 2Cg1 3Cg1 3Cg1 3Cg1
B NTC 1Cg5 1Cg5 1Cg5 2Cg5 2Cg5 2Cg5 3Cg5 3Cg5 3Cg5
C NTC 1Cg10 1Cg10 1Cg10 2Cg10 2Cg10 2Cg10 3Cg10 3Cg10 3Cg10
D NTC 1Cg25 1Cg25 1Cg25 2Cg25 2Cg25 2Cg25 3Cg25 3Cg25 3Cg25
E TC 1Cg50 1Cg50 1Cg50 2Cg50 2Cg50 2Cg50 3Cg50 3Cg50 3Cg50
F
G
H
For al reactions, the mix was placed in the well first followed by the template/standard/water (NTC)
TC was made up of 25 18-day or 3-day old larvae respective to the plate standards and was pulled from Bio 1 reps.
qPCR parameters
Changed volume reaction on methods to 50 microliters.
Plate was run at the following parameters:
    • Incubate 95C for 2 minutes 30 seconds
    • Incubate 95C for 30 seconds
    • Incubate 60C for 50 seconds
    • Plate read
    • Go to step 2, 39 more times

18-day old age class- Saved tad file as 20160208_142850

3-day old age class- Saved tad file as 20160208_122545
Results
Excel file attached includes all standard curve data for all species including the runs performed here.

Cg_SC_age10_20160115_144909

Cg_SC_age18_20160208_142850

michellenegron 9:04 PM on February 12, 2016  

DNR Geoduck Project-Michelle McCartha

SAFS- Roberts Lab
McCartha
02/05/16 Running all species standard curves with 25 microliter volume reactions
Created by: Michelle McCartha
Goal: Micah wants us to start running all reactions at a 25 microliter volume reaction instead of the current 50 microliter volume. To test the 25 microliter volume on all species, bio rep 1 standard curve will be run using the new volume to test reproducibility of data with the changed volume.
Methods
Primer and probe aliquots
No new aliquots of primers and probe were necessary as we had some left over from previous curves.
Master mix
One master mix per species was made using the following volumes of materials.
Master Mix Solutions Standard volume (μL) Multiply By new volume * 10% pipette error add  pipette error Final volume to add (μL)
Master mix 12.5 18 225 22.5 247.5 247.5
FWD Primer 0.75 18 13.5 1.35 14.85 14.85
Rev Primer 0.75 18 13.5 1.35 14.85 14.85
Probe 0.5 18 9 0.9 9.9 9.9
Water 10.5 18 189 18.9 207.9 207.9
When the master mix was made, they were inverted for mixing and spun down briefly.
The samples were set out to thaw with assistance using hand friction
The 10-day old C gigas samples were used so that they could be compared with current curve data.
When all samples were thawed, they were finger vortexed for mixing and spun down briefly.
Plate set up
The 96-well PCR plate was set up using the master mix for each species and the Bio rep 1 standard curve samples.
23microliters of the master mix was added first followed by 2 microliters of the samples.
For the NTC 2 microliters replaced the Bio rep 1 sample volume
For the TC DNA from digested TC containing DNA from 25 larvae of each species (independently) was used. There were 4 template control digestions, 1 for each species.
The plate was spun down at 2000RPM for 1 minute.
1 2 3 4 5 6 7 8 9 10 11 12
A NTC NTC NTC NTC
B NTC NTC NTC NTC
C TC TC TC TC
D 1Pg1 1Pg1 1Pg1 1Vp1 1Vp1 1Vp1 1Oly1 1Oly1 1Oly1 1Cg1 1Cg1 1Cg1
E 1Pg5 1Pg5 1Pg5 1Vp5 1Vp5 1Vp5 1Oly5 1Oly5 1Oly5 1Cg5 1Cg5 1Cg5
F 1Pg10 1Pg10 1Pg10 1Vp10 1Vp10 1Vp10 1Oly10 1Oly10 1Oly10 1Cg10 1Cg10 1Cg10
G 1Pg25 1Pg25 1Pg25 1Vp25 1Vp25 1Vp25 1Oly25 1Oly25 1Oly25 1Cg25 1Cg25 1Cg25
H 1Pg50 1Pg50 1Pg50 1Vp50 1Vp50 1Vp50 1Oly50 1Oly50 1Oly50 1Cg50 1Cg50 1Cg50
qPCR parameters
Changed volume reaction on methods to 25 microliters.
Plate was run at the following parameters:
    • Incubate 95C for 2 minutes 30 seconds
    • Incubate 95C for 30 seconds
    • Incubate 60C for 50 seconds
    • Plate read
    • Go to step 2, 39 more times

Saved tad file as 20160205_180258

Results

For some reason no data for HEX was collected during the run. Need to see if there is something that I need to do about seeing the data. FAM data was collected though and so the screen shot is for the Oly and the Gigas runs. The excel file graphs the comparisons for Bio Rep 1 on both species for both reaction volumes. There is a difference in the results that may need further testing.
Comparison of changing volume…
55.7 KBComparison of changing volume reaction 50-25